ID: 1046616387

View in Genome Browser
Species Human (GRCh38)
Location 8:116482157-116482179
Sequence CAGCAGCAGGAGAGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046616387_1046616397 17 Left 1046616387 8:116482157-116482179 CCTCCTGCCCTCTCCTGCTGCTG No data
Right 1046616397 8:116482197-116482219 AACCAGAAGTCAGAGAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046616387 Original CRISPR CAGCAGCAGGAGAGGGCAGG AGG (reversed) Intergenic
No off target data available for this crispr