ID: 1046619102

View in Genome Browser
Species Human (GRCh38)
Location 8:116509064-116509086
Sequence AAGAGGGTCAAGGGAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046619096_1046619102 -3 Left 1046619096 8:116509044-116509066 CCAAGTGAGTATCAGGAAGCAAG No data
Right 1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG No data
1046619094_1046619102 14 Left 1046619094 8:116509027-116509049 CCAAGGTTGGGGTTTTGCCAAGT No data
Right 1046619102 8:116509064-116509086 AAGAGGGTCAAGGGAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046619102 Original CRISPR AAGAGGGTCAAGGGAGTTGA GGG Intergenic
No off target data available for this crispr