ID: 1046620623

View in Genome Browser
Species Human (GRCh38)
Location 8:116525893-116525915
Sequence CTGGAAGAATAGAGGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046620615_1046620623 24 Left 1046620615 8:116525846-116525868 CCTGTTTAGTCTTCAATGACTTT No data
Right 1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG No data
1046620618_1046620623 0 Left 1046620618 8:116525870-116525892 CCACAGGTGTTCTTCTGCTGCCA No data
Right 1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG No data
1046620613_1046620623 30 Left 1046620613 8:116525840-116525862 CCCAGTCCTGTTTAGTCTTCAAT No data
Right 1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG No data
1046620614_1046620623 29 Left 1046620614 8:116525841-116525863 CCAGTCCTGTTTAGTCTTCAATG No data
Right 1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG No data
1046620617_1046620623 1 Left 1046620617 8:116525869-116525891 CCCACAGGTGTTCTTCTGCTGCC No data
Right 1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046620623 Original CRISPR CTGGAAGAATAGAGGCAGCT GGG Intergenic
No off target data available for this crispr