ID: 1046623481

View in Genome Browser
Species Human (GRCh38)
Location 8:116552666-116552688
Sequence GTGTCTCAGCCAAATCTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046623477_1046623481 15 Left 1046623477 8:116552628-116552650 CCTATTTCAATAGGGCCCCTGTT No data
Right 1046623481 8:116552666-116552688 GTGTCTCAGCCAAATCTATGTGG No data
1046623478_1046623481 0 Left 1046623478 8:116552643-116552665 CCCCTGTTTTTCAGACTTCAACA No data
Right 1046623481 8:116552666-116552688 GTGTCTCAGCCAAATCTATGTGG No data
1046623479_1046623481 -1 Left 1046623479 8:116552644-116552666 CCCTGTTTTTCAGACTTCAACAG No data
Right 1046623481 8:116552666-116552688 GTGTCTCAGCCAAATCTATGTGG No data
1046623480_1046623481 -2 Left 1046623480 8:116552645-116552667 CCTGTTTTTCAGACTTCAACAGT No data
Right 1046623481 8:116552666-116552688 GTGTCTCAGCCAAATCTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046623481 Original CRISPR GTGTCTCAGCCAAATCTATG TGG Intergenic
No off target data available for this crispr