ID: 1046634285

View in Genome Browser
Species Human (GRCh38)
Location 8:116655707-116655729
Sequence TATAACATGGAGTAATAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046634285 Original CRISPR TATAACATGGAGTAATAGTC TGG (reversed) Intronic
901369254 1:8782528-8782550 TTTAAGATGGTGTAAGAGTCTGG - Intronic
910736942 1:90469390-90469412 TATTACATGGATATATAGTCTGG - Intergenic
911245230 1:95509513-95509535 GTTAACAAAGAGTAATAGTCTGG + Intergenic
911402714 1:97396601-97396623 CTTAACATGCAGTAATGGTCAGG - Intronic
911409864 1:97489403-97489425 TATCACATGTAGTAATAATAAGG - Intronic
911429088 1:97760573-97760595 TATAAAATGGTTTAATAGTTGGG - Intronic
912943398 1:114065108-114065130 TATGATATGGTGTATTAGTCAGG + Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917759353 1:178139504-178139526 AAGAATATGGAGTAATAGTAAGG - Intronic
919420205 1:197360567-197360589 TATTACCAGGAGTAAAAGTCTGG - Intronic
921173452 1:212569742-212569764 TTTAACATAGAGTATTAGTAAGG - Intronic
923187769 1:231590577-231590599 CATAACACGGAGTAGTAGTATGG - Intronic
1063731116 10:8698126-8698148 TATAAAATAGAGGAATAGGCCGG - Intergenic
1068165436 10:53325675-53325697 TAAAACATGGAATAATAATGGGG + Intergenic
1068449968 10:57173628-57173650 TATAACATGGAGCTGTTGTCTGG - Intergenic
1068491314 10:57728081-57728103 TATAACATGGGGTTACAGTGTGG + Intergenic
1070786355 10:79164517-79164539 TATAATTTGGAGTGACAGTCAGG + Intronic
1071360499 10:84841727-84841749 TATAAAATGGTGTAGTAGCCAGG + Intergenic
1079790786 11:24736614-24736636 CATAACATGAAGTCATAGTTTGG + Intronic
1081019928 11:37932801-37932823 CATAACATGGAGTAAGACTAGGG + Intergenic
1082619504 11:55402462-55402484 TATGACATGGAGTTATGGCCAGG - Intergenic
1089871376 11:121675271-121675293 TATAAAATGGATTAAAAGTACGG - Intergenic
1090282955 11:125473497-125473519 TATAGTATGGAGTAAGGGTCAGG - Intronic
1090749805 11:129735605-129735627 AATAACATGGAGAAATATTAGGG + Intergenic
1092091214 12:5805191-5805213 CATAACAGGGACTAATAGGCAGG + Intronic
1093018438 12:14178596-14178618 TAGAACATGAAGTATTAGTAGGG + Intergenic
1094091240 12:26652613-26652635 TGTAACATTGGGTAAGAGTCTGG - Intronic
1098801070 12:74958908-74958930 TATAACATGGAGAAGTGGTTTGG - Intergenic
1099397066 12:82153693-82153715 TATAAATAGTAGTAATAGTCTGG + Intergenic
1100956049 12:99909614-99909636 TATAATATGGAAAAATAGTATGG - Intronic
1101077204 12:101143042-101143064 TACACCATGGAGTACTACTCAGG + Intergenic
1101213750 12:102560723-102560745 TATGAAATGGTGTATTAGTCAGG - Intergenic
1101739772 12:107491898-107491920 TATAAAAGGGAGTGATTGTCTGG + Intronic
1107783125 13:43926428-43926450 TAAAATATGGTGTATTAGTCAGG + Intergenic
1109019453 13:57068548-57068570 AATAACATGGAATAATTATCAGG + Intergenic
1110050298 13:70888320-70888342 TGTAACCTAGCGTAATAGTCAGG + Intergenic
1110378300 13:74819819-74819841 TATTGCATGGTGTATTAGTCAGG - Intergenic
1112916897 13:104562524-104562546 TATAACAAGGAGGTTTAGTCTGG - Intergenic
1118366111 14:65097807-65097829 TATAACATAAAATAATAGGCAGG + Intronic
1122699883 14:103581094-103581116 TATAAAATGGTGTAACAGGCTGG - Intronic
1131383600 15:91984249-91984271 TCAAACCTTGAGTAATAGTCTGG - Intronic
1132052952 15:98625689-98625711 TATAAAATGGGGTAATAGGCTGG + Intergenic
1132250635 15:100333173-100333195 TATAACATGGGGTAGTGGGCTGG - Intronic
1134884804 16:17781125-17781147 AAGAATATGCAGTAATAGTCAGG - Intergenic
1138801790 16:60040564-60040586 TATATCATGGAATAGTACTCAGG + Intergenic
1140783261 16:78315752-78315774 GATAACATGGAGTCATTGTAAGG - Intronic
1141374127 16:83514168-83514190 TATTGCATGGAGTAATTGTGAGG - Intronic
1145192598 17:20857554-20857576 TATAACATGCAGTTGTAGTCAGG + Intronic
1145403121 17:22560624-22560646 TATAACATGCAGTTGTAGTCAGG + Intergenic
1149712275 17:58754700-58754722 TATAAAATGGAATAATTGGCCGG + Intergenic
1151138649 17:71971260-71971282 TAGAAGATGGAGAAATGGTCTGG + Intergenic
1156164923 18:34406995-34407017 TATAAGATGGGGAAATAGTGGGG - Intergenic
1156398621 18:36720908-36720930 AATAAAATGGAGTAAAAGTATGG + Intronic
1156505455 18:37587733-37587755 TTTACCATGGAGTAATGGTACGG + Intergenic
1158516716 18:58136887-58136909 ACTAAAATGGAATAATAGTCTGG + Intronic
1159208651 18:65286681-65286703 TATACCATGGAATACTACTCAGG + Intergenic
1167848946 19:52187479-52187501 TATATCATAGAGTTATTGTCAGG + Intergenic
925539000 2:4946114-4946136 TATGAAATGGAGTAATACACAGG - Intergenic
927234746 2:20860799-20860821 TATAATATGGAGCTATAGCCAGG - Intergenic
927622025 2:24671359-24671381 TATAAAATGGTGTAGTAGCCAGG + Intronic
931216692 2:60251493-60251515 GATAATATAGAGTATTAGTCAGG + Intergenic
933625640 2:84595590-84595612 TAAAACATAAAGTAAAAGTCAGG - Intronic
934044577 2:88162043-88162065 TGTCACGTGGAGGAATAGTCAGG + Intergenic
936543729 2:113372771-113372793 CATAACATGGAGGAAGAGTGTGG + Intergenic
937536632 2:122896801-122896823 AACAAGATGGAGTAGTAGTCAGG + Intergenic
937614748 2:123908350-123908372 TATAACATGGAGTCAGAGAAAGG + Intergenic
939654256 2:144803263-144803285 TATAACATGCAGTTCTACTCTGG - Intergenic
939781137 2:146449665-146449687 TTTCACATGGTGTAACAGTCAGG + Intergenic
939973061 2:148683727-148683749 TATACCATGGAATACTACTCAGG - Intronic
940732883 2:157414731-157414753 TAAAACATGGAGTAATTGAAAGG + Exonic
940748993 2:157602398-157602420 TATAACATGCAGAAATGGTTAGG + Intronic
941157620 2:161998588-161998610 TGAAACATAGAGTAATAGTTAGG + Intronic
943007834 2:182408237-182408259 AATAGCTTGGAGTAATAGTGTGG - Intronic
943100828 2:183484173-183484195 TATACCATGGAGTATTACTCAGG - Intergenic
945012179 2:205477181-205477203 TATAACATGGAATATTCTTCTGG + Intronic
945978634 2:216290447-216290469 TATAACAGGGATCAAGAGTCAGG + Intronic
1169385895 20:5149241-5149263 TATATCATGGATTATTAGTGAGG + Intronic
1169563865 20:6831300-6831322 TATAATATAAAGTAATAGTAAGG + Intergenic
1179303351 21:40132735-40132757 AATAACAGGGAGTCATTGTCAGG + Intronic
1181907572 22:26211476-26211498 TATAAAATGGAGTAGCAGTGTGG - Intronic
949629361 3:5905999-5906021 TAAAGCATGGTGTATTAGTCAGG - Intergenic
957761308 3:84560990-84561012 TATATCATGGAGTAAAATTCAGG - Intergenic
959078702 3:101778463-101778485 TAAACCTTGGGGTAATAGTCCGG + Intergenic
959349806 3:105247994-105248016 TATAACATGGAGAAATTATGAGG - Intergenic
966271033 3:178106033-178106055 TAAAATATGTTGTAATAGTCAGG - Intergenic
975177619 4:71306284-71306306 TATAAAATGGGATAATAGGCTGG + Intronic
976199598 4:82564986-82565008 TATAAAAAGGAGTAAGAGGCCGG - Intergenic
978602053 4:110439080-110439102 TTTTACATGGTGTATTAGTCAGG + Intronic
987462673 5:18231815-18231837 TGTATCATTGAGTAATAGTTTGG + Intergenic
987481179 5:18459790-18459812 TATAACATAGACAATTAGTCTGG + Intergenic
987551201 5:19384190-19384212 AATAAGCTGGAGTAATAGACAGG + Intergenic
993298853 5:86181742-86181764 TTTAACATGGAATACTACTCAGG + Intergenic
994088245 5:95783427-95783449 TTTAAAATGGAATAATAGGCCGG + Intronic
994904538 5:105821386-105821408 TACACCATGGAGTACTACTCAGG + Intergenic
995036095 5:107536141-107536163 TAGAACAAGGAGTAATTGTATGG - Intronic
996206214 5:120740028-120740050 TCAAACATTGAATAATAGTCCGG - Intergenic
996660919 5:126001866-126001888 TATAAAATGGAGTAATAATAAGG - Intergenic
1000881867 5:166707060-166707082 TATAACATTGAATAATACTGTGG + Intergenic
1001235621 5:170026872-170026894 TAAAACATGGAGCAAATGTCAGG - Intronic
1002963005 6:1934767-1934789 TGTAACATGGAGTAAAAATGAGG - Intronic
1005411256 6:25549368-25549390 TTCTAGATGGAGTAATAGTCCGG - Intronic
1006235368 6:32626234-32626256 TATAAAATGCTGTAATAGGCCGG - Intergenic
1006493981 6:34408035-34408057 TTTAAAATGGCGTAATAGGCTGG + Intronic
1008596393 6:53046503-53046525 TATAACAAGGAGGAATTGTTGGG - Intronic
1014264616 6:119262224-119262246 TATAAAATAGAGTAAAAGTGAGG + Intronic
1014917257 6:127166788-127166810 AATAACATGCAGTTAGAGTCAGG - Intronic
1015359563 6:132323093-132323115 GATAACATGTAGAAATGGTCTGG - Intronic
1019843388 7:3472856-3472878 GAGAACATGGGGTAACAGTCAGG + Intronic
1022148489 7:27572837-27572859 TTTATAATGCAGTAATAGTCTGG - Intronic
1025621964 7:63181575-63181597 TGTTACATGGTGTATTAGTCAGG + Intergenic
1027590934 7:80117884-80117906 TTTAACATGGTGTATTAGTCAGG - Intergenic
1028198254 7:87932524-87932546 TATACCATGGAATACTATTCAGG + Intergenic
1029267954 7:99357246-99357268 TATCTCATGTAGTAAAAGTCAGG + Intronic
1031515525 7:122693657-122693679 TATAAAAGGGAGTAAGAGGCTGG + Intronic
1034441533 7:151088076-151088098 GATAACATGGAGTTATGGGCAGG + Intronic
1037296140 8:17402607-17402629 TATACAATGGAGTACTATTCAGG - Intronic
1037682020 8:21105441-21105463 AATAATATGGAGAAATAGGCTGG - Intergenic
1038387400 8:27161851-27161873 TGTACAATGGAGTAGTAGTCAGG + Intergenic
1038433316 8:27516873-27516895 TATAACATGGAGGAAACTTCAGG - Intronic
1039202178 8:35107834-35107856 TATAGCATGGAGCAACAGGCTGG - Intergenic
1039766253 8:40631583-40631605 TAAAACATGGAACAATAGGCAGG - Intronic
1042604261 8:70529934-70529956 TAAAACATGGATTACTAGCCAGG - Intergenic
1046634285 8:116655707-116655729 TATAACATGGAGTAATAGTCTGG - Intronic
1048544662 8:135375664-135375686 TATAACATGCAGCAAGTGTCAGG + Intergenic
1050421350 9:5468457-5468479 TAAAACATGGAGTATTTGTAAGG + Exonic
1053087461 9:35238480-35238502 TATAACATGGAGCGATGTTCAGG - Intronic
1053882329 9:42608349-42608371 TATAAAAGGGGGTAAGAGTCTGG - Intergenic
1053890340 9:42685944-42685966 TATAAAAGGGGGTAAGAGTCTGG + Intergenic
1054221354 9:62415817-62415839 TATAAAAGGGGGTAAGAGTCTGG - Intergenic
1054229360 9:62493356-62493378 TATAAAAGGGGGTAAGAGTCTGG + Intergenic
1055763338 9:79633664-79633686 TATAAAATGGGGTAACACTCTGG - Intronic
1186008263 X:5099278-5099300 TATAAACTGGAGCAATAGTATGG - Intergenic
1191201059 X:57782138-57782160 TAGAAACTGGAGTGATAGTCAGG - Intergenic
1191820047 X:65296154-65296176 TATACCATGGAATACTACTCAGG + Intergenic
1192357832 X:70420442-70420464 GAGAACATAGAGTAGTAGTCTGG - Exonic
1192910173 X:75595452-75595474 TATACCATGGAATATTACTCAGG + Intergenic
1194038087 X:88904384-88904406 TATATCATGGAATACTACTCAGG - Intergenic
1196290196 X:113930789-113930811 TTTAAAATGGAATAATATTCTGG - Intergenic
1196810477 X:119625178-119625200 TATAATATGCAGAAATAGTCTGG - Intronic
1197379586 X:125722765-125722787 TATGACCTGGTGTATTAGTCCGG - Intergenic
1198648138 X:138831581-138831603 TCTAAAATGGAGAAATAGGCAGG - Intronic
1201784823 Y:17763726-17763748 TATAGCAAGGAATAAGAGTCAGG - Intergenic
1201816729 Y:18142261-18142283 TATAGCAAGGAATAAGAGTCAGG + Intergenic
1202033472 Y:20604863-20604885 TATACCATGGAATACTACTCAGG + Intergenic