ID: 1046644595

View in Genome Browser
Species Human (GRCh38)
Location 8:116771813-116771835
Sequence TCTGAGAAGCAGAATGCAGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 509}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046644593_1046644595 -10 Left 1046644593 8:116771800-116771822 CCCAAAAGTACTTTCTGAGAAGC 0: 1
1: 0
2: 5
3: 36
4: 295
Right 1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG 0: 1
1: 0
2: 0
3: 41
4: 509

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046644595 Original CRISPR TCTGAGAAGCAGAATGCAGA AGG Exonic
900094036 1:933132-933154 TGTGCGAAGCAGGGTGCAGAGGG + Intronic
901350970 1:8596391-8596413 TCTGAGAAACTGATTGGAGATGG - Intronic
902210924 1:14903922-14903944 GATGAGAAGCAGACTGCGGAAGG + Intronic
902760258 1:18576159-18576181 TTTGACAAGTAGAATGCAGCAGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
904180632 1:28664286-28664308 TCTGAGAATGTGGATGCAGAAGG + Intergenic
906504381 1:46367212-46367234 TTGGAGATGAAGAATGCAGATGG - Intergenic
907416160 1:54315400-54315422 TATGAGAAGCACACAGCAGATGG + Intronic
907627435 1:56043816-56043838 TCTGGGAAGCAGAACTGAGAAGG - Intergenic
907827393 1:58032049-58032071 TTTGAGAAGCAGAGTTTAGAAGG - Intronic
908039747 1:60097841-60097863 TCAGAGAAACCGAATGCAGCTGG + Intergenic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
909710028 1:78638580-78638602 GCTCAAAAGCAGAATGGAGAGGG - Intronic
911125077 1:94333801-94333823 TCTGAGAAGCTCAGTGCTGAAGG - Intergenic
911854469 1:102859360-102859382 ACTGAGGGGCAGAAAGCAGAAGG - Intergenic
913262479 1:117012109-117012131 TCTGAGAAGCATAACTAAGAGGG + Intronic
913536706 1:119779888-119779910 TCTGAGAGGGAGGAAGCAGAGGG + Intergenic
914909737 1:151775166-151775188 TCTGAGAAGAAAAATGAAAAGGG + Exonic
914972391 1:152320352-152320374 TCTTATAAGCAGAATACAGTTGG - Intronic
915556894 1:156665712-156665734 TCTGAGCAGCAGAGTCCAGCAGG - Intergenic
916051863 1:161042060-161042082 TCTGAGAAGTAAGATGAAGAAGG - Intronic
916383972 1:164246257-164246279 TCTCAGAAGCAGGAGTCAGAAGG + Intergenic
916786825 1:168092633-168092655 TCTGAGAAGCTGAAAGAACAGGG + Intronic
919559814 1:199102510-199102532 TCATAGAAGCAGAAAGTAGAAGG - Intergenic
919749186 1:201025958-201025980 TCTGAGCAGCAGAACCCAGGGGG - Intergenic
920058035 1:203206744-203206766 TCTGAGATGCAGAATGAAAAAGG - Intergenic
920339474 1:205267049-205267071 TCTGAGAAGCAGAGTCCTGAAGG + Intronic
920712680 1:208310116-208310138 TGGAAGCAGCAGAATGCAGATGG - Intergenic
920763959 1:208813042-208813064 TGTGAGAACCAAAATTCAGAAGG - Intergenic
921389036 1:214601089-214601111 TCTGAGAGTAAGAATGGAGATGG + Intergenic
921403274 1:214750393-214750415 TTTGAAAAGTAAAATGCAGAAGG - Intergenic
921421110 1:214949444-214949466 TCTGAGAAGGATTATGAAGAGGG + Intergenic
922489118 1:226000968-226000990 GCTGGGGAGCAGACTGCAGAGGG - Intergenic
922625115 1:227032608-227032630 TTTGACCAACAGAATGCAGAAGG + Intronic
923029928 1:230240969-230240991 TCTTAGTAGCAAAATGGAGATGG - Intronic
923945823 1:238886229-238886251 ACCGAGGGGCAGAATGCAGAAGG + Intergenic
924092870 1:240520331-240520353 TCCAAGCAGCAGAATGCAGGGGG + Intronic
924450951 1:244178564-244178586 TCTGAGAAGCATCATGCTAATGG - Intergenic
924736769 1:246764224-246764246 TCTGTGAAGGAGAAGGCAAAGGG - Exonic
924902475 1:248416338-248416360 TCTAAGTAGCAGGCTGCAGAGGG + Intergenic
1063373683 10:5538814-5538836 TCTGAGACGCAGAATGTACCTGG - Intergenic
1064452890 10:15459357-15459379 TCTGTGAAGCAGTATGGGGAGGG - Intergenic
1064924442 10:20554739-20554761 TCTGAGAAGGAGAAGGATGAAGG - Intergenic
1066084421 10:31962485-31962507 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1067512291 10:46906110-46906132 TCTGAGGTGCATAAGGCAGAAGG - Intergenic
1067828883 10:49598565-49598587 TCTGAGAAGCATCTGGCAGAGGG - Intergenic
1068168778 10:53365891-53365913 TTTGAGAAGCAGAATGGGAATGG + Intergenic
1068624617 10:59228545-59228567 TCAGAGATGCAGTATGCTGAGGG - Intronic
1071749828 10:88462006-88462028 TCTTAGAAGCATAAAGCATATGG - Intronic
1073180886 10:101582529-101582551 ACTGAGAACCAGAATCTAGAGGG + Intronic
1073265768 10:102227604-102227626 CCTGGCAAGCAGAAGGCAGAGGG - Exonic
1074537911 10:114341887-114341909 TTTGAGAGGCATAAGGCAGAAGG + Intronic
1074718073 10:116238361-116238383 TCTTGGAGGCTGAATGCAGATGG - Intronic
1074879841 10:117647327-117647349 ACTGAGAAGCAGCATGGACAGGG + Intergenic
1076207336 10:128613563-128613585 GCAGAGAAGCAGAAAGCAGGTGG - Intergenic
1076474120 10:130740578-130740600 GGTGAGAATCAGGATGCAGATGG - Intergenic
1076812324 10:132893804-132893826 ACTGAGGAGCATAAAGCAGAAGG - Intronic
1077869681 11:6251312-6251334 TCTGACCAGCAGAGAGCAGAAGG + Intergenic
1079471927 11:20786650-20786672 TCTGAGGGGCATAAGGCAGAAGG + Intronic
1079850423 11:25526425-25526447 TCAAAGAGGCAGAATGGAGAAGG + Intergenic
1080245416 11:30174553-30174575 TCTTAGAAGAAGAATACAGGAGG - Intergenic
1080254916 11:30279969-30279991 CCTGAGAAACAGAATCCACAGGG + Intergenic
1081144557 11:39546683-39546705 GCTGGGAAGCAGAAAGCAGGTGG - Intergenic
1081428974 11:42955334-42955356 TCTGAGGACAAGGATGCAGAAGG + Intergenic
1081719197 11:45274577-45274599 TCTGAGAAGCAGGGTGCAGGGGG + Intronic
1082753482 11:57047706-57047728 TCTGAGAATGACAATGGAGAGGG - Intergenic
1082942726 11:58725608-58725630 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
1083825971 11:65204343-65204365 GCTGAGAAGCAGAAGCCAGGCGG - Intronic
1084764745 11:71301059-71301081 TCTCAGAAGCTGAGAGCAGAAGG - Intergenic
1084792167 11:71481865-71481887 TCGGAGAAGCAGCATGCCCATGG - Intronic
1085256806 11:75178801-75178823 TCATAGAAGCAAAAAGCAGAAGG - Intronic
1086013662 11:82137666-82137688 TTTGGGAAGCTGAATGCAGTAGG + Intergenic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1086728519 11:90219884-90219906 TCTTTTAAGCAGATTGCAGAGGG - Intronic
1086737115 11:90320442-90320464 TTTGAGGGGCAGAAGGCAGAAGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087247681 11:95858829-95858851 ACTATGAAGCAGAATTCAGAGGG + Intronic
1087705131 11:101481545-101481567 TCTAAGAGGGAGAATACAGAAGG - Intronic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088712673 11:112522824-112522846 TTCCAGAAGCAGAATGGAGAAGG + Intergenic
1088930658 11:114347976-114347998 ATTGAGAGTCAGAATGCAGAGGG + Intergenic
1089324443 11:117647687-117647709 TCTGATTAGCAGAAAGCAAAAGG + Intronic
1089473709 11:118741507-118741529 TCTCAAAAGCAGAATGAAGCTGG + Intergenic
1089644669 11:119870891-119870913 TCTAAGAAGGAGAATAAAGAAGG + Intergenic
1090239064 11:125169329-125169351 ACTGAGAAGCAGAATTTAGAGGG + Intronic
1090246273 11:125218130-125218152 TCTGAGGAGCTGGATGCAGGAGG + Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091328912 11:134715038-134715060 TCAGATCAGCAGAATGGAGAGGG + Intergenic
1092068038 12:5608612-5608634 TCTGAGAAGCAGCTTGCCCATGG + Intronic
1092813605 12:12293996-12294018 TTAGAGAAGCAGAGTGCCGAGGG + Intergenic
1092836446 12:12493503-12493525 TCTGAGAAAAAGAGTTCAGAGGG - Intronic
1093652069 12:21657535-21657557 GCGGAGGAGCAGAAGGCAGAGGG - Exonic
1093800639 12:23367665-23367687 TAAGAGAAGCAGAAATCAGAGGG + Intergenic
1093825255 12:23677190-23677212 TCTGAGGAGCAGAATGGAAAGGG - Intronic
1096582020 12:52591852-52591874 TCTGAGGATGAGAATGTAGAAGG - Intronic
1096666549 12:53170126-53170148 TCTGAAAAAGAAAATGCAGAGGG + Exonic
1096686347 12:53290827-53290849 GATGAGAACCTGAATGCAGAGGG - Exonic
1097051944 12:56229016-56229038 TCTGAGAACCAGAATGGGAATGG + Exonic
1097931567 12:65193168-65193190 ACTGAGAGGCATAAGGCAGAAGG + Intronic
1098874091 12:75848838-75848860 TCTGGGAAGCAGCATGATGAGGG - Intergenic
1098954128 12:76670955-76670977 TCTAAGAAGAGGAATGCAGATGG + Intergenic
1099309980 12:81006838-81006860 TCTTAGAAGCAGATTCCACATGG + Intronic
1099913068 12:88857468-88857490 GCTAAGAAGCAAAATCCAGAAGG - Intergenic
1100258387 12:92907382-92907404 TCTGAGATGGAGAATGTAGATGG - Intronic
1100643444 12:96504888-96504910 TATGAAAAGCAAAAAGCAGAAGG - Intronic
1101864444 12:108510065-108510087 TCTGAGCCCCAAAATGCAGAAGG + Intergenic
1103654850 12:122462562-122462584 TCTGAGCATCAGAATAAAGAAGG + Intergenic
1103733287 12:123042703-123042725 TTTGGGAAGCAGAGAGCAGAAGG - Intronic
1104234359 12:126918640-126918662 CCATAGAGGCAGAATGCAGATGG - Intergenic
1104943498 12:132405514-132405536 TCTCAGAGACAGAAAGCAGAAGG + Intergenic
1105554156 13:21429871-21429893 ACTGAACAGCAGAATGGAGAGGG - Intronic
1105636215 13:22217995-22218017 ACACAGCAGCAGAATGCAGAGGG + Intergenic
1106827202 13:33536648-33536670 TCTGAAAAGCAGAATTAAAAGGG + Intergenic
1107299111 13:38947072-38947094 TGTGAAAAGCAAAGTGCAGATGG - Intergenic
1107462018 13:40613357-40613379 TCGGAGAAGCAGATTGTAAAGGG - Intronic
1107591540 13:41912112-41912134 TCTAAGATGGATAATGCAGAAGG - Exonic
1108021898 13:46136177-46136199 TCCCAGAAGCAGGAGGCAGAAGG - Intronic
1108187557 13:47903286-47903308 TCTCTGAAGCTGAATGAAGAAGG + Intergenic
1108702141 13:52952823-52952845 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1108905418 13:55465171-55465193 TCAGAGAAGTACAATGCAGCAGG - Intergenic
1109333848 13:60966966-60966988 ACTGAGGAGCATAAGGCAGAAGG - Intergenic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1111621009 13:90725943-90725965 CCTTAGAAAAAGAATGCAGAGGG + Intergenic
1112606809 13:100914414-100914436 TCTGACAAGGAGTAGGCAGATGG + Intergenic
1112973685 13:105291163-105291185 TCTGAGGAGTTGCATGCAGAAGG + Intergenic
1113901993 13:113802684-113802706 GCTGAGAAGCAGATGGCAGGAGG - Intronic
1114401654 14:22415844-22415866 TCTGAGAGGTAGAATTCAGTTGG - Intergenic
1114656312 14:24317792-24317814 TCTGTGCAGAAGGATGCAGAAGG + Exonic
1115025851 14:28745458-28745480 CCTGAGAAGAAGATTGCAGTGGG + Intergenic
1115063517 14:29224553-29224575 TATGATAAGCTCAATGCAGATGG + Intergenic
1115193650 14:30773506-30773528 TCTGTGAAGCAGAGTTCAGTGGG - Intergenic
1115367488 14:32574795-32574817 TCAGAAAAGCAGAATTTAGATGG - Intronic
1115882694 14:37937823-37937845 TATGAGAATCAGAGTGGAGAAGG + Intronic
1116439550 14:44936677-44936699 TCTGAGCAGCAGAATGTAACTGG - Intronic
1117152139 14:52900582-52900604 TTTGGGAAGCAGAAGTCAGATGG + Intronic
1117197249 14:53353029-53353051 ACTGAGGAGCATAAGGCAGAAGG - Intergenic
1117951886 14:61091033-61091055 TCACAGACCCAGAATGCAGAAGG + Intergenic
1118054923 14:62069886-62069908 TCTCAGATGCAGAGTGCAGAGGG - Intronic
1118805297 14:69231246-69231268 TCTGAGGAGAAGAAGGAAGAAGG - Intronic
1119064156 14:71509158-71509180 TCTGAGAAACAGAAAGCATATGG - Intronic
1119462946 14:74825957-74825979 TCTGAGAAGCAAATGGTAGACGG - Intronic
1119542441 14:75449510-75449532 GGTGAGAAGCAGAATGCATCTGG - Intronic
1120095022 14:80378779-80378801 CATGAGAAGCAGAATGCAAGAGG + Intronic
1120478847 14:85023705-85023727 TCTGAGATGAAGATTCCAGAGGG - Intergenic
1120824286 14:88941380-88941402 TTTGAGAAGCATGATGAAGAAGG - Intergenic
1121230339 14:92352923-92352945 TCTGAAAAGCAGAATGTTGGGGG - Intronic
1121298201 14:92847352-92847374 TCTGAGCTGCAGACTGCAGGAGG + Intergenic
1121476453 14:94211385-94211407 TCTGAGGAGCAGAAAACTGAAGG + Intronic
1123431008 15:20216330-20216352 ACTGAGGGGCAGAAGGCAGAAGG - Intergenic
1124174740 15:27413658-27413680 TTTAAGACGGAGAATGCAGAGGG + Intronic
1125034161 15:35104561-35104583 TCTGACAAGCAGCATGTAGTAGG + Intergenic
1125731220 15:41893734-41893756 TCTGAGAAGAAGAATCTGGAAGG - Intronic
1126368615 15:47922208-47922230 ACTTAAGAGCAGAATGCAGATGG - Intergenic
1126688032 15:51265335-51265357 TAAGGGAAGCAGAAAGCAGATGG + Intronic
1127524919 15:59783647-59783669 TGTCAGAAGCAGACTTCAGAAGG - Intergenic
1127575123 15:60284470-60284492 TCTGAGGAGCATAAGGTAGAAGG + Intergenic
1128701993 15:69811536-69811558 GCTGAGTAACAGAATGCACAGGG - Intergenic
1128751177 15:70150664-70150686 TCTTACAAGCAGATTTCAGAGGG + Intergenic
1128923561 15:71633760-71633782 TCAGAGTAGCAGAATGGATATGG + Intronic
1131891832 15:96980789-96980811 TCTGGGAAGAAGCATGGAGATGG + Intergenic
1132131004 15:99279446-99279468 TCTGAGTAGCAGATTGCCCAGGG - Intronic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1132823557 16:1890601-1890623 TGTGAGCAGCAGAAAGCGGATGG - Intergenic
1133865519 16:9638365-9638387 TCTGGGAAGCAGAAGGTAGCAGG - Intergenic
1134229796 16:12419895-12419917 TCTGACTAGCAGAAGGGAGATGG + Intronic
1134474914 16:14564811-14564833 TGAGAGAAGCAGAAAGCAGATGG - Intronic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135214525 16:20553652-20553674 TCTGAGAAAGAAAATTCAGAAGG - Intronic
1136026618 16:27472792-27472814 TCAGAGGAGGAGAATGGAGAGGG - Intronic
1136853645 16:33634917-33634939 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1137313979 16:47297332-47297354 TCTTATAAGCAGCATGTAGATGG + Intronic
1137384702 16:48030604-48030626 TCTGAGATGCCCAATGCAGAGGG - Intergenic
1137956999 16:52841748-52841770 AATGAGAAGCAGAACACAGAGGG + Intergenic
1138785891 16:59845968-59845990 TGAGAGAAGCAGAATGAAAAAGG - Intergenic
1138918163 16:61493696-61493718 TGAGAGAAGCAGATTGGAGAGGG + Intergenic
1139337960 16:66246348-66246370 GCTGAAGATCAGAATGCAGATGG + Intergenic
1139730330 16:68938746-68938768 TTTGAGTAGCAGAGTCCAGAAGG + Intronic
1140128056 16:72134209-72134231 ACTGAGGGGCAGAAGGCAGAAGG - Intronic
1140616073 16:76665841-76665863 ACTGAGCTGCAGACTGCAGAAGG - Intergenic
1142407473 16:89898787-89898809 GATGAGCAGCAGCATGCAGAGGG - Exonic
1203115236 16_KI270728v1_random:1483362-1483384 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1142545126 17:695928-695950 GCTAAGCAGCAGAATGCAGCTGG + Intronic
1143449895 17:7029847-7029869 TCAGAGCAGCAGGATGCAGGTGG - Intronic
1143773587 17:9183359-9183381 TCGCACAAGCAGAATGCAGGGGG + Intronic
1144126874 17:12211026-12211048 TCTGAGAAGCAGAGAGAAAATGG + Intergenic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1147490297 17:40859769-40859791 TCAAAGAAGCAGAAGGGAGAGGG - Intergenic
1148060264 17:44831062-44831084 TCTGAGCATCAGAATGCCGATGG + Intergenic
1148792804 17:50183187-50183209 TCTGGGAAGGAGCAGGCAGAAGG + Intergenic
1149651767 17:58280294-58280316 TCAGAGAAGCAGCAGGCAGCAGG - Intronic
1149662094 17:58339354-58339376 CTTGAGTAGCAGAAGGCAGAGGG - Intergenic
1150862788 17:68818382-68818404 TCTGGAGAGCAGAAAGCAGATGG - Intergenic
1151245997 17:72795173-72795195 TCTGAGACTCAGAATCCAGGAGG + Intronic
1151300913 17:73224740-73224762 CCAGAGAAGCAAAAGGCAGAGGG - Intronic
1151689366 17:75672131-75672153 TCTGGGATGCAGAATGCAAGTGG - Intronic
1151821716 17:76500540-76500562 TCTGAGGAGCAGAAGGCGGTGGG - Intronic
1152468482 17:80478106-80478128 GCTGAGATGCTGAACGCAGACGG - Intergenic
1152502655 17:80723064-80723086 TTTGGGAAGAATAATGCAGATGG + Intronic
1152708661 17:81859312-81859334 GCTGGGAAGCTGAAGGCAGAAGG - Exonic
1153268373 18:3294800-3294822 TGTGAGATTCAGAAAGCAGATGG + Intergenic
1153289354 18:3485174-3485196 TCTGAGAATTAGAATGCAGCAGG - Intergenic
1153485879 18:5597225-5597247 TCTGAGAAGCAGAATGACTAAGG - Intronic
1153958626 18:10121240-10121262 TCACAGAAGCAGAGAGCAGAAGG + Intergenic
1154155188 18:11938875-11938897 TATAAGAAGCAGACTACAGAGGG - Intergenic
1154384699 18:13882460-13882482 TCTAAGAAACAAAATGAAGATGG - Exonic
1154962349 18:21322112-21322134 TATTATAAGCAGAATTCAGAAGG + Intronic
1155368363 18:25071961-25071983 GCTGAGAACCAGAGGGCAGAAGG + Intronic
1155423797 18:25684864-25684886 GGTGAGGAGCAGAAGGCAGAAGG - Intergenic
1156083868 18:33375883-33375905 ACTGAGAAGCATAAGGCAGAAGG + Intronic
1157012856 18:43672280-43672302 TCTGATAAACAGAAAACAGAGGG - Intergenic
1157412866 18:47478490-47478512 TCTGGGAAATAGAATTCAGAAGG - Intergenic
1157607728 18:48936585-48936607 TCTGGGAAGCTGAATCCCGAGGG + Intronic
1158934994 18:62356401-62356423 TTTTAGAATCAGAATTCAGAGGG - Intronic
1159649824 18:70964943-70964965 TCAGGGAAGCAGAATCCTGAAGG + Intergenic
1159844921 18:73447853-73447875 TGTGAGAGGCAGGATGCACAGGG + Intergenic
1161154243 19:2723914-2723936 TCTGAGCAGCAGTTTCCAGATGG - Intronic
1161180050 19:2874306-2874328 TCTAAGATTTAGAATGCAGAAGG + Intronic
1161338158 19:3725758-3725780 CCTGAAAAGCAAAAAGCAGAAGG - Intronic
1163640161 19:18457483-18457505 TCTGGAAAGCAGAATGAAGTTGG - Intronic
1164681083 19:30134133-30134155 CATGAGAAGCAGAATTCAGATGG - Intergenic
1165183410 19:33994018-33994040 TTTGAGGAGCATAAGGCAGAAGG - Intergenic
1165391522 19:35541928-35541950 GCTGGGAAGCAGAAAGCAGCCGG + Intronic
1167654303 19:50753499-50753521 TCAGAGATGAATAATGCAGATGG + Intergenic
1168081247 19:54012110-54012132 TGTGAGCAGCAGAAAGCAGCCGG - Exonic
925078154 2:1037161-1037183 AGAGAGAAGCAGAAGGCAGATGG - Intronic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
925097624 2:1219894-1219916 TTTCAGAAGAAGAAGGCAGATGG + Intronic
925141462 2:1552633-1552655 GCTTAGTAGCTGAATGCAGATGG + Intergenic
925488348 2:4362544-4362566 TCTTAGAAGCAGAGAGTAGATGG - Intergenic
925951418 2:8915866-8915888 TGAGAGAACCAGGATGCAGAAGG - Intronic
926049728 2:9737179-9737201 CCTGAGCAGATGAATGCAGATGG + Intergenic
926247514 2:11132045-11132067 TCATAGAAGCAGAATCCAGCAGG + Intergenic
926556497 2:14364035-14364057 TCTGAGGGGCATAAGGCAGAGGG + Intergenic
926800040 2:16652328-16652350 CCTGAGGAGCAGGATTCAGATGG + Intronic
928197086 2:29223798-29223820 TCCAAGAAGCAGACTGGAGATGG + Intronic
928767079 2:34660154-34660176 TCTGGGAGGCAGAGTTCAGATGG + Intergenic
928899022 2:36297997-36298019 TCTGTGAGACAGAAAGCAGATGG + Intergenic
929009196 2:37424341-37424363 ACTGAGCAGCATAAGGCAGAAGG + Intergenic
929980499 2:46674797-46674819 TCTGAGATGATTAATGCAGATGG - Intergenic
930438260 2:51374549-51374571 TCTGAGTAGCAGAGAGCACAGGG - Intergenic
930685796 2:54306753-54306775 TCTCAGAAGCAGCATGCAAAGGG - Intergenic
932091967 2:68813905-68813927 TCTCACAAGCATATTGCAGATGG - Intronic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932440912 2:71734341-71734363 TGTGAGCAGCAGGGTGCAGAGGG - Intergenic
933595566 2:84279751-84279773 TCTGAGTACCATAATGAAGAAGG + Intergenic
933642844 2:84782600-84782622 TGTCAGAAGCAGCCTGCAGAAGG - Intronic
933970635 2:87467171-87467193 TCTGGCAAGCAGAGGGCAGATGG - Intergenic
935377694 2:102416964-102416986 TGTGAGAAACAAAATGCACATGG + Intergenic
935672735 2:105569849-105569871 AGTGAGGAGCAGGATGCAGAAGG + Intergenic
935801378 2:106700148-106700170 GCTGAGGAGAGGAATGCAGAAGG + Intergenic
936081191 2:109433847-109433869 CTTGAGAAGCAAACTGCAGAGGG + Intronic
936168415 2:110145240-110145262 TCTGAGGAGCAGAATTGAGGAGG - Intronic
936323094 2:111483011-111483033 TCTGGCAAGCAGAGGGCAGATGG + Intergenic
936618587 2:114072839-114072861 TTTGAGAGGCAAAATGGAGAAGG - Intergenic
937838456 2:126498139-126498161 CCTCAGCAGCAGAATGCAGTTGG + Intergenic
940046420 2:149415391-149415413 TCTGTGAAGCACATGGCAGAAGG + Intronic
940317077 2:152336503-152336525 TGGGAGAAGCGGAATGCAGGAGG - Intronic
940868978 2:158844136-158844158 TCTGAGAAGAAAACTCCAGAGGG - Intronic
940906231 2:159172329-159172351 TCTGAGAAGTAGATTGGAAAAGG + Intronic
941017226 2:160371296-160371318 TTTGAGAGGCAAAATGTAGAAGG - Intronic
941536640 2:166730425-166730447 ACTGAGAGGAAGAAGGCAGAAGG + Intergenic
941864456 2:170319837-170319859 TCTGAAAAGTAGAAGTCAGAAGG + Intronic
942154764 2:173116651-173116673 GGTTAGAAGCAGGATGCAGATGG - Intronic
942787652 2:179718883-179718905 TCATAGAAGCAGACAGCAGAAGG + Intronic
942832084 2:180249406-180249428 TCAGAGCAGCAAAAGGCAGAAGG + Intergenic
944032246 2:195249406-195249428 TCACAGAAGCAGAAAGTAGAAGG + Intergenic
944502921 2:200380211-200380233 TCACAGCAGCAGAATGCAAATGG - Intronic
944970545 2:204987895-204987917 GCTGACAAGCAGAATCCAAAGGG + Intronic
945132571 2:206589435-206589457 TATGAAAAGCTGAATACAGAAGG + Exonic
946311493 2:218884551-218884573 TCTGAGAAGTAGAAGGTAGAAGG - Intronic
946530270 2:220563263-220563285 TCAGAGAGGCAGAAAGTAGACGG + Intergenic
947133121 2:226950225-226950247 TCACAGAAGCAGAGAGCAGAAGG - Intronic
947139125 2:227004751-227004773 ACTGAGAATCAGAACCCAGAAGG + Exonic
948014509 2:234677084-234677106 ACTCAGATGCAGACTGCAGATGG - Intergenic
948678131 2:239611084-239611106 TCTGAGAAGCAGCTGTCAGATGG - Intergenic
948869805 2:240792209-240792231 TGTGAGAAGCAGGCTGCTGAAGG - Intronic
948917543 2:241043071-241043093 TCTGCGAAGGAGGATGGAGATGG + Intronic
1169071335 20:2733514-2733536 TCTGAGAAGGAGAGTAGAGATGG - Intronic
1170431468 20:16280464-16280486 GATGTGAAGCAGAATGCAGAGGG + Intronic
1170624174 20:18018906-18018928 TCTGTGCAGCAGAATGGGGATGG - Intronic
1171185547 20:23121758-23121780 TCAGAGATGCAGGATACAGAAGG - Intergenic
1171964750 20:31521186-31521208 TCTGAGGAACAGAATCCTGAAGG - Intronic
1174756106 20:53160132-53160154 TCTGAAGAACAGAATGCAGGAGG + Intronic
1175631005 20:60536385-60536407 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1175825054 20:61932162-61932184 TCTGAGCAGCAGGAGGGAGATGG - Intronic
1176285633 21:5017845-5017867 ACTGAGACTCAGACTGCAGAGGG - Intergenic
1178597949 21:33972017-33972039 TCTTATAAGAAGAAGGCAGAGGG - Intergenic
1179066192 21:38026897-38026919 GCAGAAAAGCAGGATGCAGAAGG - Intronic
1179162294 21:38908575-38908597 GCTGAGAGGCATAAGGCAGATGG - Intergenic
1179871548 21:44245630-44245652 ACTGAGACTCAGACTGCAGAGGG + Intergenic
1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG + Intronic
1180920710 22:19520163-19520185 GCTGAGCAGCAGAGTGCCGAGGG + Intronic
1180982737 22:19886495-19886517 TGTGAGCAGCAGGATGCAGGTGG + Intronic
1182977189 22:34634487-34634509 TGTAAGAAGCACAAGGCAGAAGG + Intergenic
1183004738 22:34891700-34891722 ACTGAGAAGAAGAAAGCAGGTGG - Intergenic
1183607907 22:38877483-38877505 TTTGACCAACAGAATGCAGAGGG - Intergenic
1183708028 22:39487075-39487097 GCGGAGAAGCAGGCTGCAGAGGG + Intronic
1184034203 22:41910864-41910886 TCTGAGGAACAGAACCCAGACGG + Intronic
1184139421 22:42569757-42569779 TCTGAGAAGCAGAAAATAGCTGG + Intronic
1185170884 22:49293336-49293358 CCTGTGAAGCAGCATACAGAAGG - Intergenic
1185263529 22:49884944-49884966 CCTGAGAAGCAGCAGGCTGATGG + Exonic
950641719 3:14352758-14352780 TTTGGGATTCAGAATGCAGAGGG - Intergenic
951130731 3:19040309-19040331 TCTGAAAAGCAGTGTTCAGAGGG - Intergenic
951279996 3:20736403-20736425 TCTGTGAAGCAGAAAACTGAGGG + Intergenic
951621996 3:24612675-24612697 TCTTAGAAGCAGAATACGGTTGG + Intergenic
952101322 3:30016546-30016568 TTTGGGAGGCAGAATGGAGATGG + Intergenic
952520575 3:34152880-34152902 TCTGAGAGGCTGCAGGCAGATGG - Intergenic
953259333 3:41322387-41322409 TCTGAGGGGCATAAGGCAGAGGG - Intronic
953499942 3:43423573-43423595 TCTGTGAAGCTGACTGCAGAGGG + Intronic
953685488 3:45074890-45074912 ACTGAGAAGGAGAAGCCAGAGGG + Intergenic
953833611 3:46324326-46324348 TTTGAGGAGGAGCATGCAGAAGG - Intergenic
954653364 3:52178692-52178714 CCTGAGGAGCAGCAGGCAGAAGG + Intergenic
954869793 3:53759068-53759090 TCTAGGAAGCAGAAGGCAGGTGG - Intronic
955052832 3:55429348-55429370 TCTGTGCAACAGAAAGCAGAGGG - Intergenic
955618899 3:60839968-60839990 TCTGAGAGGCAGCATGAAGGTGG - Intronic
956482629 3:69688323-69688345 TCTGAGACCCAGGAAGCAGAAGG - Intergenic
956772382 3:72537476-72537498 TCAGACAAACAGAATGCAGATGG - Intergenic
956937870 3:74124433-74124455 TCTGAGAGTCAGAAAGCAGATGG + Intergenic
957848589 3:85774421-85774443 TATGCCAAGCAGAATGCACAAGG + Intronic
958600519 3:96290252-96290274 TGAGAGAAGCAGGATACAGAAGG - Intergenic
958753714 3:98224776-98224798 TCTTATAAGGTGAATGCAGAAGG + Intergenic
959333353 3:105034705-105034727 ACTGAGCAGCATAAGGCAGAAGG + Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960270193 3:115665513-115665535 TCTGAGAATGATAATGAAGAAGG - Intronic
960484985 3:118240643-118240665 TGTGGGAACCAGAAAGCAGAGGG - Intergenic
962632812 3:137296894-137296916 TCTCAGAAGCAAAAGGCAAAAGG - Intergenic
963299213 3:143580285-143580307 TCTGAAGGGCAGAATGCAAATGG - Intronic
963466748 3:145691410-145691432 TCTGAGAAGCAGATGTCAGTGGG - Intergenic
963616479 3:147544939-147544961 TTTCATAAGAAGAATGCAGATGG + Intergenic
964037833 3:152219921-152219943 TATTAGAAGTAGAAGGCAGACGG + Intergenic
964062592 3:152541568-152541590 TCTTATAAGCAGTATGCAGTTGG - Intergenic
964721454 3:159770741-159770763 CCTGGAAAGCAGGATGCAGATGG - Intronic
964759885 3:160124854-160124876 TCTGAGAAGCAGGATTGATAAGG - Intergenic
964868649 3:161289378-161289400 TATGTGAGTCAGAATGCAGATGG - Intergenic
965003132 3:162983782-162983804 TTTGAGTAGCAGAGTACAGAAGG - Intergenic
966632395 3:182092721-182092743 CCAAAGAAGCAAAATGCAGAAGG - Intergenic
966985884 3:185179960-185179982 GCTGAGAAGGAGGATGGAGAAGG + Intergenic
967242188 3:187450823-187450845 GCTGAGAAGTTGAATGCAGGGGG - Intergenic
967457917 3:189711202-189711224 TCTGAAAAGCAAATTGTAGATGG - Intronic
967492766 3:190112547-190112569 TCTGAAAAGAAGAGAGCAGAGGG - Intronic
967676715 3:192307858-192307880 TCTCAGATGAAAAATGCAGAGGG - Intronic
967828380 3:193897390-193897412 TCTGAGATGCAGATTCCCGAGGG + Intergenic
968348632 3:198033191-198033213 GTTGGGAAGCAGAATGCACATGG - Intronic
968602328 4:1516078-1516100 TGTGATGAGGAGAATGCAGAAGG + Intergenic
969327459 4:6452160-6452182 TTTGACAAGCAGAAGGCAGTTGG - Intronic
969904340 4:10379280-10379302 TCAGAGAAGTATAATACAGAGGG + Intergenic
969933488 4:10657718-10657740 TCAGGGCAGCAGAATCCAGACGG + Intronic
970161338 4:13192523-13192545 GGTGAGAAGCTGAATGCCGAGGG - Intergenic
970275416 4:14394442-14394464 TATGAGAAGAAAAATCCAGAAGG - Intergenic
970300921 4:14680685-14680707 TCTGAGCAGCAGAGTTCACAAGG + Intergenic
971548554 4:27918770-27918792 TATGAGAACTAAAATGCAGAGGG + Intergenic
972173197 4:36373481-36373503 TTTGATTAGCAAAATGCAGATGG + Intergenic
972651592 4:41022551-41022573 TGTGAGAAGTAGACTCCAGAGGG - Intronic
972842438 4:42947240-42947262 TCTGAGAACCAGAAGGCTCAGGG + Intronic
972863230 4:43198222-43198244 TCTGAGCAACAGAATGCTTAGGG + Intergenic
973265177 4:48203451-48203473 TGTGAGAAGCACATTGCAGGGGG - Intronic
973846235 4:54915930-54915952 CCTGAGAGCCAGAATACAGAAGG + Intergenic
974086554 4:57267154-57267176 TCTGAGAAGCTGCAATCAGAAGG - Intergenic
975271623 4:72442007-72442029 TCAGAGAGGCACAATGCAGATGG + Intronic
975708317 4:77133600-77133622 TCTGAGAAGCATAAAGCACTAGG + Intergenic
976132152 4:81896116-81896138 TGAGAGGAGCAAAATGCAGAGGG - Intronic
976361899 4:84189518-84189540 ACTGAAAAACAGAATACAGATGG + Intergenic
976948950 4:90805393-90805415 GCTGAGAAGCAGAAACCACATGG - Intronic
977178044 4:93839321-93839343 TCTCTGTAGCAGAATGGAGAAGG - Intergenic
977401724 4:96541125-96541147 TCTGGGAAGGAGAGGGCAGAAGG + Intergenic
978149576 4:105416809-105416831 TATGAAAAGGAGAATGGAGAAGG - Intronic
978153723 4:105466556-105466578 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
978772485 4:112471407-112471429 TCAGAGACTCAGAAGGCAGAAGG + Intergenic
979295423 4:119027240-119027262 TCTGACAGGCAGAAGACAGAAGG + Exonic
979557124 4:122061856-122061878 GCTGAGAAGGAGAAAGAAGAGGG - Intergenic
980044794 4:127975337-127975359 TCATAGAAGCAGAAAGTAGAAGG - Intronic
980870387 4:138604618-138604640 TCTCAGAAGCAGAGAGGAGAAGG - Intergenic
980875986 4:138662624-138662646 ACTGAGAAGCAAAAGGCAGTTGG - Intergenic
980964418 4:139507007-139507029 TCTGCGAGGCAGAAGTCAGAAGG + Exonic
980991607 4:139743094-139743116 TCTGGGAAGCAGAGTGAAGGTGG - Intronic
981060970 4:140425408-140425430 TCAGAGAAGCAGAATCAATAGGG + Intronic
981622460 4:146717921-146717943 TCAAAGAAGCAGAGAGCAGAAGG - Intronic
982344663 4:154344343-154344365 TCTGTGAAGCACAATGAAGTGGG + Intronic
982382329 4:154762293-154762315 CCTCACAATCAGAATGCAGAGGG + Intergenic
982971024 4:161986725-161986747 TCTGAAAAGCAGGAGGCAGGAGG + Intronic
983060066 4:163149741-163149763 TGTGTGTATCAGAATGCAGAAGG + Intronic
984466547 4:180106825-180106847 TCAGAGAAGAGGACTGCAGAAGG + Intergenic
984957686 4:185061964-185061986 TTACAGAAGCAGAAAGCAGATGG + Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
985355874 4:189117817-189117839 TGTGAGAAAAAGAATTCAGAAGG + Intergenic
985727064 5:1522184-1522206 TCCGAGCAGCAGAGTGCAGGAGG + Intronic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
985924753 5:3007105-3007127 TCTGAGCAGCAGAAGACAGTTGG + Intergenic
985980841 5:3461819-3461841 TCTGAGAAGCACTAGGCACATGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
987946871 5:24621196-24621218 TCAGAGAAGCAGTGTGCACAAGG + Intronic
987984356 5:25126941-25126963 TCTGAGAAACAGAATACCTAGGG + Intergenic
988776002 5:34478575-34478597 TTTGAGGGGCAGAAGGCAGAAGG + Intergenic
989781332 5:45267984-45268006 TCTGGAAGGCAGAAAGCAGATGG + Intronic
991203204 5:64018284-64018306 TCTAAGAATCAGTATGTAGAAGG - Intergenic
991503440 5:67300564-67300586 TCTGAGAATTAGAAGGCACAGGG + Intergenic
992097580 5:73377199-73377221 TCTGGGGAGCTGAAAGCAGAGGG + Intergenic
992389323 5:76315741-76315763 TGTGAGAAGCAGAATAAACAAGG + Intronic
992420309 5:76597305-76597327 TCTGAAAAGCTGCAGGCAGAGGG - Intronic
992728346 5:79632103-79632125 CCAGAGAAACAGAGTGCAGAAGG + Intronic
992795936 5:80255525-80255547 TCCGACAAGCAGAGTGGAGAGGG + Intronic
993364864 5:87022822-87022844 ACTGAGCAGCATAAGGCAGAAGG - Intergenic
994748209 5:103705536-103705558 TGTGAGGAGCAGAATGGTGATGG - Intergenic
994929156 5:106158271-106158293 TATGAAATGCAGAATCCAGAAGG - Intergenic
996512703 5:124334979-124335001 CCTGAGAAAGAGAATGCAGTTGG + Intergenic
996859957 5:128054177-128054199 ACTGAGCAGACGAATGCAGAGGG - Intergenic
996998131 5:129724481-129724503 ACTGAGAAGCATAAGGCAGAAGG + Intronic
998166111 5:139845016-139845038 TTTGAGAGGCAGAGTGGAGAAGG + Intergenic
998334642 5:141360676-141360698 GCTGAGAAACAGACTCCAGATGG + Exonic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
999468417 5:151829169-151829191 GCTGAGAAGCAGACAGCAGTGGG - Intronic
999882876 5:155886795-155886817 TCTGTGAAGGAGAATGCCCAGGG + Intronic
999975011 5:156903630-156903652 CCAGAGAAGGAGACTGCAGACGG + Intergenic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000334551 5:160232313-160232335 TTTGAGAAGGAGAAGTCAGATGG - Intronic
1000684173 5:164226345-164226367 TTAAAGATGCAGAATGCAGATGG - Intergenic
1000813027 5:165886243-165886265 CCTGAGAAGCAGAAAGCAATTGG - Intergenic
1001946576 5:175783816-175783838 CCTGAGAACCAGAAAGCTGATGG + Intergenic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002993935 6:2265060-2265082 TCTGACAAGGAGAAGGCATAGGG + Intergenic
1005964894 6:30720337-30720359 TCTGAGAGGGAGAAAGGAGAGGG - Exonic
1006918370 6:37610926-37610948 ACTGTGGAGGAGAATGCAGAAGG + Intergenic
1007425989 6:41746476-41746498 TCTGGGAAGGAGAGTGCCGAGGG - Intronic
1008124923 6:47657241-47657263 TCTGAGAAGAAGAATGTGTAAGG - Intronic
1009195268 6:60677042-60677064 TCTAAGAAGCATAGTGAAGAAGG - Intergenic
1009401552 6:63262302-63262324 ACTGAGGAGCATAAGGCAGAAGG + Intergenic
1009666931 6:66694511-66694533 TATGAAAAGCATAAAGCAGAAGG - Intergenic
1011027443 6:82884751-82884773 TCTGAGAAGGAAAATGCATGGGG + Intergenic
1011571136 6:88737158-88737180 TCTAAGAAGGAGAAATCAGAAGG - Intronic
1012953801 6:105546951-105546973 TCTGTGTACCAGCATGCAGATGG - Intergenic
1012957399 6:105586185-105586207 TCAGAGCAGGAGAATGAAGAGGG + Intergenic
1013342154 6:109225423-109225445 TCTAAGTAGCAGGATGGAGAAGG + Intergenic
1014257920 6:119182677-119182699 AATGAGAACCAGATTGCAGATGG - Intronic
1014588585 6:123232513-123232535 TCTGAGAAGCAGAAAGGGCAAGG + Intronic
1015718053 6:136212125-136212147 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718055 6:136212152-136212174 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718057 6:136212179-136212201 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718059 6:136212206-136212228 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718061 6:136212233-136212255 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015718063 6:136212260-136212282 TCTGAGTTGCAGTATGGAGATGG + Intergenic
1015874421 6:137808740-137808762 TCTGAGGAGCTGAATGCTGGGGG + Intergenic
1016593216 6:145768922-145768944 GCTGAGAAAAAGAATCCAGATGG - Intergenic
1017198828 6:151730441-151730463 TCTGAGAAGCAGGACACACATGG - Intronic
1018238897 6:161753483-161753505 TCTTAGAAGCAGTACGAAGAAGG + Intronic
1018968742 6:168509846-168509868 TCAGAGCAGCAGAAAACAGAAGG - Intronic
1019485002 7:1285311-1285333 TCTGGGAAGCCGAACCCAGAGGG + Intergenic
1020147012 7:5652391-5652413 TGTGAGTAACAGAATTCAGAGGG - Exonic
1021064643 7:16158322-16158344 TCCTAGAAACAGAATTCAGAAGG - Intronic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1021542078 7:21770843-21770865 TCTGAGAAGAAGATTCCGGAGGG - Intronic
1022213548 7:28235724-28235746 TATGAGATGCTGGATGCAGAGGG - Intergenic
1022630259 7:32077991-32078013 TCTGAGAGGCAGAATGTCCACGG - Intronic
1022909437 7:34885978-34886000 CCTGAGAAGACTAATGCAGATGG + Intergenic
1023088890 7:36599833-36599855 ACTGAGAGGCAGAAAGCAGGAGG - Intronic
1023537626 7:41230729-41230751 TGTGAGAAAAAGAATTCAGAAGG - Intergenic
1023684309 7:42719056-42719078 TCTGAGGAGCATAAGGCAGAAGG + Intergenic
1024348016 7:48333210-48333232 TCTCAGTAGAAGAATGGAGATGG - Intronic
1024774424 7:52765873-52765895 TCTGAAACACAGAAGGCAGAAGG - Intergenic
1026618197 7:71926302-71926324 GCTGTGAAGCAGTATGCAGTGGG - Intronic
1026799574 7:73391162-73391184 TCTTAGAAGCAGTTTGGAGAGGG - Intergenic
1027409625 7:77901378-77901400 TTTGGGAAGCTGAAGGCAGAAGG + Intronic
1027868692 7:83678780-83678802 GCTGAGATGCAGAAAGCAGTAGG + Intergenic
1028581187 7:92411174-92411196 ACTGAGGAGCATAAGGCAGAAGG + Intergenic
1029092559 7:98059495-98059517 TCTGAGCAGCAGAAATCAAAAGG + Intergenic
1029282929 7:99448302-99448324 GCTGAGAACCAGGGTGCAGAGGG + Intronic
1030031762 7:105376340-105376362 TCTGAGATGAAGAATGCCGTAGG - Intronic
1030083183 7:105795084-105795106 TGTGAGAAGCAGATTTCAGCGGG - Intronic
1030515553 7:110533792-110533814 ACTGAGAGGCATAAGGCAGAAGG - Intergenic
1030649759 7:112104555-112104577 TCTGAGAATCAGTTTTCAGAAGG + Intronic
1031458274 7:122011545-122011567 TTTGAGAAACTGTATGCAGATGG - Exonic
1031878373 7:127167739-127167761 TCTGAGAAGAAGGAGGGAGATGG - Intronic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1032732599 7:134658482-134658504 TGTGTGAAGCAGAGTGCAGCTGG - Exonic
1033212706 7:139471934-139471956 GCTGGGAAGCACAATACAGAAGG + Intronic
1033339533 7:140480811-140480833 TGTGAAAAGCACAATGCAAAGGG - Intergenic
1033647120 7:143313996-143314018 TCATAGAAGCAGAAAGTAGAGGG - Intergenic
1034227552 7:149495699-149495721 ACTGAGAACTAGAATGCGGATGG + Intronic
1034975127 7:155444176-155444198 TCATAGAAGCAGAAAGTAGAAGG + Intergenic
1035063126 7:156084123-156084145 TCACAGAAGCAGAGAGCAGAAGG - Intergenic
1035134191 7:156684597-156684619 CCTGAGAAGCACACTTCAGATGG - Intronic
1035161403 7:156952839-156952861 TCTGAGAAGCAGGAAGGAAAGGG + Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1036669788 8:10775350-10775372 TTTGAGAAGCAGCATGCTGGAGG - Intronic
1037236046 8:16720531-16720553 TCTGAGCAGCACAAGGCAGAAGG - Intergenic
1037244781 8:16821260-16821282 TTGTAGAAACAGAATGCAGAAGG + Intergenic
1037583615 8:20261553-20261575 TTTGGGAGGGAGAATGCAGAAGG - Intronic
1038379051 8:27075112-27075134 TCTGGGAATCAGGATGGAGAGGG + Intergenic
1038416639 8:27401289-27401311 TCTGAGGAGCCCAAGGCAGAGGG + Intronic
1038621604 8:29148666-29148688 TCTGAGCAGCTGGATGTAGACGG - Exonic
1039220481 8:35325126-35325148 ACAGATAAGCAGAATTCAGAGGG + Intronic
1039770030 8:40676441-40676463 TCTGAGATGTAGGATGCAGCTGG + Intronic
1041321526 8:56618740-56618762 TCTGAGAGACAGAAGGAAGAAGG - Intergenic
1041392092 8:57355990-57356012 TCAGAGCAGCAGAGTCCAGATGG - Intergenic
1041882334 8:62766425-62766447 TCAGAGAATCAAAATACAGAGGG - Intronic
1042096717 8:65224114-65224136 TCTGAGAATCAGATTTCACAGGG + Intergenic
1042183820 8:66117648-66117670 TGTGAGAAGTGGATTGCAGAAGG + Intergenic
1042409173 8:68442533-68442555 TCTGAGAAGCAGAGAGCAAGTGG + Intronic
1042985890 8:74582422-74582444 GCTTAGAACTAGAATGCAGAGGG + Intergenic
1043364579 8:79517798-79517820 GCTGAGAAGGAGAAGGCAGAGGG + Intergenic
1043408254 8:79962310-79962332 TCTGAGAAGCACAAGGCAAGGGG + Intronic
1044352922 8:91187495-91187517 TCTGGGAAGCTGAATGCTAAAGG + Intronic
1044933449 8:97271677-97271699 TCTGATATGTGGAATGCAGAAGG - Intergenic
1045154210 8:99448935-99448957 TCAGAGAAGTAGAATGGAAAGGG - Intronic
1045186265 8:99841657-99841679 ACTGAGAAGCAGTAGGCAGAAGG - Intronic
1045326387 8:101120718-101120740 TTTGAGAAGCAAAATGAAAAAGG - Intergenic
1045357381 8:101401912-101401934 CCTCAGAGACAGAATGCAGAGGG - Intergenic
1046154666 8:110272328-110272350 TCTCTGAAGCAGATTCCAGAAGG + Intergenic
1046174166 8:110553158-110553180 TCCCATAAGCAGAATGCAGTAGG - Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1048012530 8:130469719-130469741 GCTGAAAAGCAGCATTCAGAAGG + Intergenic
1048803103 8:138212491-138212513 CCTGAAAAGCAAAAGGCAGAGGG - Intronic
1049353049 8:142174502-142174524 CCTGAGAAGCAGGCAGCAGAGGG - Intergenic
1050346642 9:4695376-4695398 TCTGAGAAACAGAATGATTATGG - Intronic
1051339624 9:16099586-16099608 TCTGAGAAGCAGCTTGTGGAAGG + Intergenic
1051572698 9:18578366-18578388 TCTGAGATGCAGGGTGAAGAGGG - Intronic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055445015 9:76374089-76374111 TCTGAGAAGCCAAATCCAGATGG - Intergenic
1056316560 9:85395997-85396019 GCTGAGAAGGAGACTGCAGGTGG + Intergenic
1056684497 9:88748390-88748412 TCTTAGAAGCAGAAAGTAGAAGG - Intergenic
1056688366 9:88785103-88785125 TCAGAGAAACAGGATGCTGATGG + Intergenic
1057410726 9:94814692-94814714 ACTGAGAGTCAGAATGCAAAGGG + Intronic
1057847506 9:98536893-98536915 ACTGAGGAGCAGGATGGAGAAGG - Intronic
1058561019 9:106229231-106229253 CCTTGGAAGTAGAATGCAGAAGG + Intergenic
1058610107 9:106766732-106766754 TCTGAGAAGTAGAATGGGTATGG + Intergenic
1059540380 9:115124647-115124669 CCTGAGAAACAGAATGTACAAGG - Intergenic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1186927602 X:14352296-14352318 TCTGGGCAGCAGAATGGAGATGG + Intergenic
1187509941 X:19908636-19908658 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1187789166 X:22929810-22929832 TCTGGGAATTAGAAAGCAGATGG - Intergenic
1188021452 X:25163101-25163123 TCTGAGTAGGAGGATGCAGAAGG - Intergenic
1188754957 X:33951162-33951184 TCTCAAAAGAAGAATGCAAAGGG + Intergenic
1189695579 X:43658204-43658226 TCTGAATTGCAGAATACAGATGG - Intronic
1190795442 X:53736941-53736963 TCTGAAAAGTAGAAAGAAGAAGG + Intergenic
1193629509 X:83865192-83865214 TCTGAGATGCAGAATACTTATGG - Intronic
1194079434 X:89440496-89440518 ACTGAGAAGGAGAAAGCAGTTGG + Intergenic
1194161921 X:90464674-90464696 ACTGAGAGGCATAAGGCAGAAGG + Intergenic
1194691258 X:96988378-96988400 CCTCAGAAGCAGAATCCAGCAGG + Intronic
1195413263 X:104592340-104592362 ACTGATAAGCACAATGTAGAAGG - Intronic
1195564072 X:106322109-106322131 TCTGAGATGCAGAAAACTGAGGG - Intergenic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1197388024 X:125825129-125825151 TCTGACAAGCAAAATGCTGAGGG - Intergenic
1197715870 X:129705663-129705685 TCTGAGAAGTAGACATCAGATGG - Intergenic
1198155467 X:133955508-133955530 TCTGAGAAGCAGATGCCAGTTGG - Intronic
1198786170 X:140290902-140290924 TCAGACAAGCATAATGCTGAGGG - Intergenic
1199609908 X:149604425-149604447 TATGAGAAGAAGGATGCACAAGG - Intronic
1199620014 X:149691261-149691283 TATGAGAACCACAAAGCAGAGGG - Intronic
1200049754 X:153422497-153422519 TCTGGGGAGCAGAAGGCAGTGGG - Intergenic
1200432052 Y:3095801-3095823 ACTGAGAAGGAGAAAGCAGTTGG + Intergenic
1201910024 Y:19124528-19124550 ACTGAGAGGCATAAGGCAGAAGG + Intergenic