ID: 1046645285

View in Genome Browser
Species Human (GRCh38)
Location 8:116779146-116779168
Sequence GCTAATATATTCACGTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 82}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046645285_1046645290 6 Left 1046645285 8:116779146-116779168 CCCAACAACGTGAATATATTAGC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1046645290 8:116779175-116779197 TGAATTGGTATACTTTAAATGGG No data
1046645285_1046645291 23 Left 1046645285 8:116779146-116779168 CCCAACAACGTGAATATATTAGC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1046645291 8:116779192-116779214 AATGGGTGAATTTGTGTATTAGG No data
1046645285_1046645289 5 Left 1046645285 8:116779146-116779168 CCCAACAACGTGAATATATTAGC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1046645289 8:116779174-116779196 TTGAATTGGTATACTTTAAATGG No data
1046645285_1046645287 -9 Left 1046645285 8:116779146-116779168 CCCAACAACGTGAATATATTAGC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1046645287 8:116779160-116779182 TATATTAGCAGCCATTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046645285 Original CRISPR GCTAATATATTCACGTTGTT GGG (reversed) Intronic
907683583 1:56587911-56587933 GATAATATATTCATGATTTTGGG + Intronic
908021898 1:59906575-59906597 TTAAATATATTCACATTGTTAGG + Intronic
911176891 1:94826318-94826340 ATTAGTACATTCACGTTGTTGGG - Intronic
913013517 1:114709728-114709750 GATAATATATTCCCGTTTTTAGG - Exonic
913260542 1:116993931-116993953 GAAAGTATATTCACATTGTTGGG - Intergenic
913995603 1:143650076-143650098 GGTAATATAATAACTTTGTTGGG - Intergenic
918564001 1:185904473-185904495 GCTAATCTATTCATTATGTTTGG + Intronic
921984494 1:221297329-221297351 GCCAAGATATTTACATTGTTAGG - Intergenic
924950382 1:248876865-248876887 TCTAATATAGTCATGTTTTTTGG + Intergenic
1063591375 10:7399104-7399126 GCTGATATCTTCACAGTGTTGGG - Intronic
1065982303 10:30911961-30911983 AATAATATTTTCATGTTGTTGGG - Intronic
1066555555 10:36608913-36608935 GCTTAAATATTCACATTGTAAGG + Intergenic
1080927311 11:36770796-36770818 ACTAAAATATTCAATTTGTTTGG - Intergenic
1085041509 11:73329066-73329088 GATGATATATTCACATGGTTAGG + Intronic
1085954068 11:81369234-81369256 CCAAATACATTCAAGTTGTTGGG - Intergenic
1097134314 12:56838931-56838953 GCTAAAATATTCACTTCCTTTGG + Intergenic
1097320922 12:58225419-58225441 ACTGATATATTCACCTTGTCTGG + Intergenic
1099024196 12:77444909-77444931 ATTAATACATTCACATTGTTAGG - Intergenic
1102747277 12:115260257-115260279 GGTAACATATTCAGCTTGTTGGG + Intergenic
1108327695 13:49350125-49350147 TGCAATATATTCACATTGTTAGG - Intronic
1115072127 14:29336691-29336713 GCTAATATATGGACCTTATTTGG + Intergenic
1118071387 14:62250010-62250032 CCAAATATAGTCACATTGTTAGG + Intergenic
1118563152 14:67108869-67108891 GTAAATATATTCACATTGTAGGG + Intronic
1120209574 14:81621720-81621742 GCTAATATTTTAGCCTTGTTTGG + Intergenic
1124462814 15:29908611-29908633 GCTAATAAATTCACCCTCTTGGG - Intronic
1126256474 15:46632496-46632518 GCTAATCTACTCTAGTTGTTTGG + Intergenic
1129528923 15:76245772-76245794 GCTTATATGTTCAGGTGGTTAGG + Intronic
1133487390 16:6233439-6233461 GGTAATATAATCAGGCTGTTTGG - Intronic
1133695542 16:8259166-8259188 TTAAATACATTCACGTTGTTGGG + Intergenic
1149756981 17:59195103-59195125 CCTAATATATACATTTTGTTGGG - Intronic
1150172647 17:63015635-63015657 GCTAATATTCTCATGTCGTTAGG - Intronic
1153558850 18:6349561-6349583 GCTAATTTATTCACTGTTTTAGG - Intronic
926248205 2:11136694-11136716 TTTAATATATTCACGGAGTTGGG - Intronic
933804033 2:85984983-85985005 GCTAATAAATTCAAATTGTATGG + Intergenic
936983381 2:118285110-118285132 GATAATATTTTCACGGTGATAGG + Intergenic
939080360 2:137653885-137653907 GCTCACATATCCATGTTGTTAGG + Intronic
943347871 2:186761814-186761836 GTTAATATGTTTAGGTTGTTTGG - Exonic
944280408 2:197889575-197889597 GCAAATATGTTCAAGTTTTTAGG + Intronic
944881296 2:204015493-204015515 GTTAAAATATTCAAATTGTTTGG - Intergenic
946465421 2:219907654-219907676 TCTAATATTTTCATGTTCTTAGG - Intergenic
947687618 2:232103596-232103618 GCTAATTTATTCATGATTTTTGG + Intronic
1169727317 20:8749619-8749641 TCTAATAAATTCAAGTTGGTAGG + Intronic
1178611943 21:34090626-34090648 TCTAGTATATTCAGGTTGTAGGG + Intronic
1183711537 22:39506903-39506925 GTAAGTATATTCACATTGTTGGG + Intronic
951894439 3:27597911-27597933 ACAAATATATACACGTGGTTGGG + Intergenic
952680848 3:36089782-36089804 GCTAAAATATTAGTGTTGTTAGG - Intergenic
955992756 3:64645593-64645615 GCCAATATATTCACCTTCTTTGG + Intronic
956958022 3:74363684-74363706 GGTAATACATTCATTTTGTTGGG + Intronic
958899839 3:99872699-99872721 GCTAATGTGTTCTCGTTCTTGGG + Intronic
961607510 3:128107749-128107771 TCTGATATATTCGTGTTGTTTGG - Intronic
962622753 3:137196165-137196187 GGTAATATATTCACGTGGTCTGG + Intergenic
963593188 3:147288521-147288543 GCTAATATATTGACATTGTGAGG + Intergenic
964198926 3:154095787-154095809 ACTTATAAATTCACTTTGTTGGG - Intergenic
967326732 3:188248182-188248204 TCCATTACATTCACGTTGTTTGG - Intronic
972069085 4:34992695-34992717 TCTAATACATTCTTGTTGTTTGG - Intergenic
974744866 4:66058778-66058800 GGTAATGTATCCACATTGTTTGG + Intergenic
977240466 4:94562245-94562267 GCTTATATATTCAGTTTTTTTGG + Intronic
977933728 4:102777162-102777184 GTTAATATATTCACGAGGTTGGG - Intergenic
981615783 4:146642122-146642144 GCTTGTAAATTCACATTGTTTGG + Exonic
983180990 4:164648887-164648909 CTTATTATATTCACGTTGTGTGG - Intergenic
996259875 5:121453882-121453904 GCTAATATATCCATGTTCTAAGG - Intergenic
1005165292 6:22912828-22912850 ACTAATATATTCTCGTTGCTGGG - Intergenic
1005832864 6:29684702-29684724 GCTAATATATTCAGTAGGTTAGG - Intergenic
1010026325 6:71221758-71221780 GGAAATATATTTACGTTGTTGGG + Intergenic
1011204394 6:84876128-84876150 ACTAATATAGTCACCTTGTCTGG - Intergenic
1014065295 6:117117559-117117581 TATAATATATTCACTTTGTGAGG + Intergenic
1014208572 6:118684001-118684023 GATAATATTTTCTCTTTGTTTGG + Intronic
1016200878 6:141406875-141406897 GCTATTATATTAAAGTGGTTAGG - Intergenic
1022613068 7:31896346-31896368 GGTAATAAATTCACGTAGTTTGG - Intronic
1032380124 7:131470524-131470546 CGTAGTATATTCACTTTGTTTGG + Intronic
1032809230 7:135393859-135393881 ACTCATATTTTCAGGTTGTTGGG - Intronic
1033990629 7:147281631-147281653 ACTAATATATTCACATTTATTGG + Intronic
1036380650 8:8234337-8234359 TATAAAATATTCACTTTGTTGGG - Intergenic
1043932593 8:86107876-86107898 GCTAATATATTGCCGTTCTCAGG - Intronic
1046645285 8:116779146-116779168 GCTAATATATTCACGTTGTTGGG - Intronic
1048340582 8:133535648-133535670 GCTAATGTTTTCACTTTTTTTGG + Intronic
1052689483 9:31799419-31799441 GCTAATATATTCACTTGTTTGGG - Intergenic
1057533295 9:95874482-95874504 GCTAATATATTCACGAATTCCGG - Intergenic
1057924786 9:99135673-99135695 TGTAATATATGCATGTTGTTCGG + Intronic
1058973776 9:110107126-110107148 GCAAAAATATTCTAGTTGTTTGG + Intronic
1186304172 X:8236315-8236337 GCTAATATAGTCACAATGTTGGG + Intergenic
1187189290 X:17018085-17018107 GTAAATATAGTCACATTGTTGGG + Intronic
1189636818 X:43019708-43019730 CCTAAAATAATCACGTTTTTGGG + Intergenic
1190433282 X:50398536-50398558 GCTAATCTATTCTTTTTGTTTGG - Intronic
1190707224 X:53040137-53040159 GCAAATATATAAATGTTGTTAGG + Intergenic
1192466817 X:71363052-71363074 TTTCATATATTCACATTGTTCGG - Intergenic
1194069320 X:89300336-89300358 ACTACTATATTCATTTTGTTCGG - Intergenic
1194861418 X:99003195-99003217 CCTAAAATATTCACATTTTTTGG - Intergenic
1199073501 X:143504726-143504748 GCTAGTATTTTCACATTCTTAGG + Intergenic
1199794920 X:151184792-151184814 TTAAATATATTCACATTGTTGGG + Intergenic
1202233455 Y:22680221-22680243 GCTCATATGTACACATTGTTTGG + Intergenic
1202309701 Y:23515937-23515959 GCTCATATGTACACATTGTTTGG - Intergenic
1202561100 Y:26154656-26154678 GCTCATATGTACACATTGTTTGG + Intergenic