ID: 1046645286

View in Genome Browser
Species Human (GRCh38)
Location 8:116779147-116779169
Sequence TGCTAATATATTCACGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046645286_1046645290 5 Left 1046645286 8:116779147-116779169 CCAACAACGTGAATATATTAGCA 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1046645290 8:116779175-116779197 TGAATTGGTATACTTTAAATGGG No data
1046645286_1046645289 4 Left 1046645286 8:116779147-116779169 CCAACAACGTGAATATATTAGCA 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1046645289 8:116779174-116779196 TTGAATTGGTATACTTTAAATGG No data
1046645286_1046645291 22 Left 1046645286 8:116779147-116779169 CCAACAACGTGAATATATTAGCA 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1046645291 8:116779192-116779214 AATGGGTGAATTTGTGTATTAGG No data
1046645286_1046645287 -10 Left 1046645286 8:116779147-116779169 CCAACAACGTGAATATATTAGCA 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1046645287 8:116779160-116779182 TATATTAGCAGCCATTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046645286 Original CRISPR TGCTAATATATTCACGTTGT TGG (reversed) Intronic
900855621 1:5179918-5179940 TCCTAATATAGGCACGTTGGGGG + Intergenic
910241674 1:85093387-85093409 TGCTAAGATAGTCACATTATTGG + Intronic
911312345 1:96308659-96308681 AGCAAATATGTTAACGTTGTGGG - Intergenic
912205065 1:107499953-107499975 TGCAAATATATACTTGTTGTGGG - Intergenic
912278696 1:108289782-108289804 TGCTGATATAGTCAGGTTCTTGG + Intergenic
912289530 1:108404575-108404597 TGCTGATATAGTCAGGTTCTTGG - Intronic
918347735 1:183620595-183620617 TCCTAATATATTGACTTGGTTGG - Intergenic
918782688 1:188723053-188723075 TCATAATATTTTCACGTTTTAGG + Intergenic
920641563 1:207756516-207756538 TTCTACTATACTCACCTTGTGGG - Intronic
921941184 1:220841608-220841630 TCCTAATATGATCACATTGTGGG - Intergenic
923164846 1:231350257-231350279 TTCTAATAAATTCCCCTTGTGGG - Intronic
924825876 1:247538500-247538522 TCCAAATATAGTCACATTGTGGG - Intronic
1065547266 10:26834440-26834462 TCCTTATATATTCTGGTTGTTGG - Intronic
1066672066 10:37851010-37851032 TGCAAATATTTTCTCCTTGTTGG - Intronic
1070529806 10:77326706-77326728 TGATAATATTTTCATGTTATTGG + Intronic
1074509200 10:114097730-114097752 TCCAAATATAGTCACATTGTGGG - Intergenic
1074682319 10:115919952-115919974 TACTAATATCATCACATTGTGGG + Intronic
1075820256 10:125301939-125301961 TCCAAATACAGTCACGTTGTGGG - Intergenic
1076289826 10:129336631-129336653 TGCTTACATTTTCATGTTGTTGG - Intergenic
1079229614 11:18638415-18638437 TCCAAATATATTCACATTGGGGG - Intergenic
1082257491 11:50047980-50048002 TGATAATATATTCATGATCTAGG - Intergenic
1086603338 11:88662852-88662874 TCCAAATATATTCAAGTTTTTGG - Intronic
1086648477 11:89255752-89255774 TGCTAATTTATTCTTGTTGGTGG + Intronic
1087423864 11:97965891-97965913 TCCTAATATATACAGGCTGTGGG + Intergenic
1089202811 11:116734786-116734808 TGCTAATATTTCCATGTTGTAGG - Intergenic
1097209262 12:57352871-57352893 TTCTAATATAATCAAGTTTTGGG - Intronic
1099800701 12:87452728-87452750 TCCTGGTTTATTCACGTTGTTGG - Intergenic
1104740300 12:131167064-131167086 TGCTGACACATTCAGGTTGTTGG - Intergenic
1106454008 13:29910845-29910867 TGCTCATATATGCACCTTGGTGG - Intergenic
1107189729 13:37566241-37566263 TGCCAATATATTCAAGTAATTGG - Intronic
1107732584 13:43363523-43363545 TTCTAATATATTCACCTTGGAGG - Intronic
1108805715 13:54153266-54153288 TGCAAATATTTTCAGTTTGTGGG + Intergenic
1108990860 13:56656276-56656298 TGTTAATATTTTCAAATTGTCGG - Intergenic
1109534170 13:63694230-63694252 TCCAAATATAGTCACGTTCTAGG + Intergenic
1109898491 13:68728939-68728961 TACTGATATTTTCACATTGTGGG - Intergenic
1110445329 13:75573752-75573774 TTCAAATATAGTCACGTTGAAGG + Intronic
1110624103 13:77632137-77632159 TCCTAATATAGTCACATTGAAGG + Intronic
1111258043 13:85698101-85698123 TGTTAATATCTTCACCTTGTAGG - Intergenic
1113718439 13:112532553-112532575 TGCCAATATATTCAAGTTAGAGG - Intronic
1114520488 14:23331406-23331428 TGCTAATATCATCACTTTGGGGG - Intergenic
1114860033 14:26505666-26505688 TGATAATATATACACTATGTAGG + Intronic
1115095906 14:29635336-29635358 TACATATATATTCATGTTGTGGG - Intronic
1116809374 14:49524541-49524563 TCCTAATACCTTCACATTGTGGG - Intergenic
1116948203 14:50855624-50855646 TGCTTATATATTCACATGGAGGG - Intergenic
1117025296 14:51613414-51613436 TGCTAATATGTTCAATTTGTAGG + Intronic
1118563151 14:67108868-67108890 GGTAAATATATTCACATTGTAGG + Intronic
1119763126 14:77167943-77167965 TCCAAATATAATCACATTGTGGG - Intronic
1124462815 15:29908612-29908634 TGCTAATAAATTCACCCTCTTGG - Intronic
1125010908 15:34874019-34874041 TGCTAATATTTTCTGTTTGTGGG - Intronic
1125497756 15:40213340-40213362 GGGTAATATATTCACTGTGTTGG - Exonic
1131300133 15:91192009-91192031 CGCTAATATATTCACTCTGGTGG - Intronic
1136027142 16:27475797-27475819 TGCCAAGATATTCTGGTTGTGGG - Intronic
1146485769 17:33241343-33241365 TGCTATTTCATTCACGTGGTGGG + Intronic
1146543687 17:33719505-33719527 TCTTAATATACTCACTTTGTTGG + Intronic
1149513425 17:57261094-57261116 TGTGAAAATATTCCCGTTGTCGG - Intronic
1149756983 17:59195104-59195126 TCCTAATATATACATTTTGTTGG - Intronic
1155736608 18:29231539-29231561 TTCTAATTTATCCAAGTTGTTGG - Intergenic
1156305983 18:35878595-35878617 TCCTAATATATATAGGTTGTGGG - Intergenic
1159231583 18:65614057-65614079 TGCATATATATTAACGTTGCAGG + Intergenic
1167153775 19:47725691-47725713 TGTAAAGATGTTCACGTTGTTGG - Intronic
926248206 2:11136695-11136717 TTTTAATATATTCACGGAGTTGG - Intronic
926960427 2:18352433-18352455 TGATAATATACTCAAATTGTGGG - Intronic
928797793 2:35044086-35044108 TCCCAATATATACACGTTGGTGG - Intergenic
932741952 2:74297783-74297805 TATTAATATATTCACATTGGGGG + Intronic
933627705 2:84620425-84620447 TGCTAATATATTCACTCTCTTGG - Intronic
934634128 2:95966900-95966922 TGCTATTTTATTCTCTTTGTAGG + Intronic
938194755 2:129317428-129317450 TGCAAATATTTTCACTTAGTTGG - Intergenic
943165779 2:184323894-184323916 TCCAAATATAGTCATGTTGTGGG + Intergenic
945259412 2:207830270-207830292 TCCAAATATAGTCACATTGTGGG - Intronic
945312622 2:208332805-208332827 TACTAGTATATTGATGTTGTTGG + Intronic
946619364 2:221544723-221544745 TCCAAATATAGTCACATTGTGGG - Intronic
1169818400 20:9682763-9682785 TGCCTATATATTCACTTTGATGG + Intronic
1175587603 20:60156793-60156815 TTATAAAATATTCACATTGTGGG - Intergenic
1175767134 20:61599417-61599439 TGCTGATGAATTCACATTGTGGG - Intronic
1178611942 21:34090625-34090647 TTCTAGTATATTCAGGTTGTAGG + Intronic
1183146148 22:35994228-35994250 TGCTAATATTTTAACTGTGTTGG - Intronic
949852582 3:8433804-8433826 TCCTAATATAGTCACCTTGGAGG + Intergenic
950885546 3:16359373-16359395 TCCAAATATAGTCACATTGTGGG - Intronic
953538852 3:43796600-43796622 TCCGAATATAGTCACATTGTGGG - Intergenic
956958021 3:74363683-74363705 TGGTAATACATTCATTTTGTTGG + Intronic
958179097 3:90034696-90034718 TGCTGATATTTTTACATTGTAGG - Intergenic
958190318 3:90175861-90175883 TGCTACTATATTCACAATCTCGG + Intergenic
958566481 3:95817893-95817915 TGCTAATATTTTCAAGTGGTTGG + Intergenic
958899838 3:99872698-99872720 TGCTAATGTGTTCTCGTTCTTGG + Intronic
959791026 3:110361490-110361512 TTGTAATATATTCACTTTGGAGG + Intergenic
960439062 3:117664469-117664491 TGGCAATAAATTCACTTTGTGGG - Intergenic
961259695 3:125591702-125591724 TGCTAATATATTAAATTTGGGGG + Intronic
962145391 3:132834894-132834916 TGATAAAATTTTCACGTTTTGGG + Intergenic
962173603 3:133128915-133128937 TGCTCATATATTGAGGTTGTTGG + Intronic
965478657 3:169188989-169189011 GGCTAATACATTCACATTATAGG - Intronic
966902654 3:184498156-184498178 TGCTAATAAATTCACATATTTGG - Intronic
971901291 4:32662264-32662286 TGCGAATATATTTATCTTGTAGG + Intergenic
972084370 4:35195759-35195781 TACTAAACTATTCAAGTTGTTGG + Intergenic
974221068 4:58971890-58971912 TGCTTATAAATTCACTTTGGTGG + Intergenic
974602536 4:64104096-64104118 TCCAAATATTTTCACGTTGAGGG + Intergenic
977395346 4:96464064-96464086 TGCTTCTATATTCTCTTTGTAGG - Intergenic
977933729 4:102777163-102777185 TGTTAATATATTCACGAGGTTGG - Intergenic
978040877 4:104059930-104059952 TCCAAATATGTTCACATTGTGGG + Intergenic
978671971 4:111260058-111260080 TGTTTATATATTCACTTGGTGGG - Intergenic
979051777 4:115944241-115944263 TGCAAATATCTTCACGTCTTTGG - Intergenic
979761674 4:124413650-124413672 TTCTAATACCTTCACTTTGTAGG - Intergenic
980790720 4:137616155-137616177 TCCAAATATTATCACGTTGTGGG - Intergenic
981628091 4:146784473-146784495 TCCTAATATCATCACCTTGTGGG - Intronic
981844339 4:149150402-149150424 TGCTAATCTATTCTCTTTGCAGG - Intergenic
981851744 4:149239721-149239743 GCCTAATATATTCACGTAGGGGG + Intergenic
983584139 4:169337944-169337966 TGCAAATATATTCTCCTGGTTGG + Intergenic
990106977 5:52276814-52276836 TGATAATATTTTCAGGTTGCTGG - Intergenic
992866894 5:80966581-80966603 TGCTAACATATTCCCTTTGGCGG - Intronic
997865722 5:137461039-137461061 TTCTAATATATGTACGTGGTTGG + Intronic
998860883 5:146442818-146442840 TCCTAATACAATCACCTTGTGGG + Intergenic
1000709647 5:164556272-164556294 TGATAATATATTCACTATTTGGG - Intergenic
1001509215 5:172306811-172306833 TGCAAATATTTTCTCCTTGTTGG - Intergenic
1005165293 6:22912829-22912851 TACTAATATATTCTCGTTGCTGG - Intergenic
1005446847 6:25932850-25932872 TTCTAATATTATCACTTTGTGGG - Intergenic
1010026324 6:71221757-71221779 AGGAAATATATTTACGTTGTTGG + Intergenic
1013868918 6:114733042-114733064 TGCTTAAATATTCATGTTCTTGG + Intergenic
1014600369 6:123404003-123404025 TTCTAATATATTAAGGTTATAGG + Intronic
1019814849 7:3192046-3192068 TGCAAATATCTTGAAGTTGTAGG + Intergenic
1020722072 7:11758598-11758620 TACGGATACATTCACGTTGTGGG - Intronic
1020968123 7:14898712-14898734 TGCAAATACATTCACATTGTTGG - Intronic
1021384858 7:20016951-20016973 TGATAAAATATTCACTTTTTTGG + Intergenic
1024099936 7:46020340-46020362 TGCAAATATTTTCACCCTGTCGG - Intergenic
1027652348 7:80884847-80884869 TGATAATATGTTGACGGTGTAGG + Intronic
1027736986 7:81945028-81945050 TCCTAATAAATTCAAGTTCTTGG - Intergenic
1037544379 8:19904018-19904040 TGAAAATATCTTAACGTTGTAGG - Intronic
1042911544 8:73832611-73832633 AGCTACTATATTGAGGTTGTAGG + Intronic
1043663267 8:82773916-82773938 TTATATTATATTCAAGTTGTTGG + Intergenic
1044100218 8:88126358-88126380 TGCTAATGCATTCATGTTTTGGG - Intronic
1044613493 8:94116894-94116916 TCCAAATATAGTCACGTTGGGGG + Intergenic
1045407599 8:101882287-101882309 TCCTAATATAATCACCTTGGGGG - Intronic
1046195160 8:110853130-110853152 TACTAATATATTCACTGTGAAGG + Intergenic
1046645286 8:116779147-116779169 TGCTAATATATTCACGTTGTTGG - Intronic
1050747985 9:8899756-8899778 TGCTAGTATATGCATGTTTTAGG + Intronic
1052689484 9:31799420-31799442 TGCTAATATATTCACTTGTTTGG - Intergenic
1060603889 9:124897122-124897144 TCCTCAAATATTCACATTGTAGG + Intronic
1060936714 9:127520198-127520220 TCCAAATATAATCACGTTCTGGG - Intronic
1186007928 X:5094862-5094884 TCCAAATATAGTCACATTGTGGG + Intergenic
1186304171 X:8236314-8236336 AGCTAATATAGTCACAATGTTGG + Intergenic
1186702220 X:12103843-12103865 TGCTAATATATTCCCTTTGTAGG + Intergenic
1186711040 X:12196874-12196896 TTCTTATATATTCACATTCTAGG - Intronic
1187189289 X:17018084-17018106 TGTAAATATAGTCACATTGTTGG + Intronic
1189636816 X:43019707-43019729 TCCTAAAATAATCACGTTTTTGG + Intergenic
1190406507 X:50093379-50093401 TCCAAATATATTCAAGGTGTTGG + Exonic
1194336930 X:92659708-92659730 TCCTAATACATTCAATTTGTGGG + Intergenic
1198245374 X:134826163-134826185 TTCTAATATCTTCACGCTTTTGG + Intronic
1200645363 Y:5776443-5776465 TCCTAATACAATCACTTTGTGGG + Intergenic