ID: 1046645290

View in Genome Browser
Species Human (GRCh38)
Location 8:116779175-116779197
Sequence TGAATTGGTATACTTTAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046645285_1046645290 6 Left 1046645285 8:116779146-116779168 CCCAACAACGTGAATATATTAGC 0: 1
1: 0
2: 0
3: 10
4: 82
Right 1046645290 8:116779175-116779197 TGAATTGGTATACTTTAAATGGG No data
1046645286_1046645290 5 Left 1046645286 8:116779147-116779169 CCAACAACGTGAATATATTAGCA 0: 1
1: 0
2: 1
3: 12
4: 132
Right 1046645290 8:116779175-116779197 TGAATTGGTATACTTTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046645290 Original CRISPR TGAATTGGTATACTTTAAAT GGG Intronic
No off target data available for this crispr