ID: 1046648444

View in Genome Browser
Species Human (GRCh38)
Location 8:116810839-116810861
Sequence GGAAATGAGGTCCCATCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046648440_1046648444 -8 Left 1046648440 8:116810824-116810846 CCGAGGAGTCTTTCAGGAAATGA 0: 1
1: 0
2: 3
3: 28
4: 394
Right 1046648444 8:116810839-116810861 GGAAATGAGGTCCCATCTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046648444 Original CRISPR GGAAATGAGGTCCCATCTCG GGG Intronic
No off target data available for this crispr