ID: 1046652373

View in Genome Browser
Species Human (GRCh38)
Location 8:116851235-116851257
Sequence AAGAATTACCAGAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 388}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046652369_1046652373 -1 Left 1046652369 8:116851213-116851235 CCAAAGTCTTTAAAAGAAACTAA 0: 1
1: 0
2: 0
3: 56
4: 654
Right 1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG 0: 1
1: 1
2: 2
3: 37
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046652373 Original CRISPR AAGAATTACCAGAAGGAGGG TGG Intronic
901088694 1:6627452-6627474 AAGAATCACCTGAACCAGGGAGG - Intronic
901860868 1:12073500-12073522 AAGAAAGAAGAGAAGGAGGGAGG - Intronic
903676539 1:25068050-25068072 AGGAAGAACCAGGAGGAGGGTGG - Intergenic
903877603 1:26486224-26486246 AGAAATTACCTGATGGAGGGTGG - Intergenic
904817227 1:33213426-33213448 AAAAAATCCCAGAAGAAGGGTGG + Intergenic
905627458 1:39498269-39498291 AAGAGGTTCCAGGAGGAGGGGGG - Intronic
906282453 1:44563515-44563537 GAGAATTTCAAGAACGAGGGAGG - Intronic
908387826 1:63659239-63659261 AAGACTTAACAGCAGGAGAGTGG + Intronic
910004801 1:82383340-82383362 AAGAAATACCAGAAGCATTGTGG + Intergenic
910499288 1:87871070-87871092 AAGAAAGAAAAGAAGGAGGGTGG + Intergenic
910910573 1:92229710-92229732 AAGAATTACCCTAAAGAAGGGGG + Intronic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
913278989 1:117167001-117167023 AAGAATAACCTGAAGCTGGGAGG + Intronic
913539189 1:119802691-119802713 AAGATTTACCAGAAAGAGAGTGG - Intronic
916067271 1:161146390-161146412 AAGAAATCCCAGGGGGAGGGGGG - Intergenic
917286752 1:173429285-173429307 AGGAAATACAAGAAAGAGGGGGG - Intergenic
917405894 1:174708489-174708511 AAGGATTAACAGAAGCAGGGTGG + Intronic
917608537 1:176661806-176661828 AAGACAGACCAGAAGGAAGGTGG + Intronic
917646904 1:177038164-177038186 AGGAGTTAGCTGAAGGAGGGAGG - Intronic
917774917 1:178322583-178322605 TAGAATGACTAGAAGGATGGTGG - Intronic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
917940063 1:179909850-179909872 AAGAATGACCTGAATGTGGGAGG - Intronic
918058458 1:181042715-181042737 GAGAATTGCCTGAAGCAGGGAGG + Intronic
918650835 1:186961154-186961176 GAGGATTACCAGAAGCTGGGGGG + Intronic
918820963 1:189253724-189253746 AATAGTTAACAGAAGGAGGGGGG + Intergenic
918991211 1:191699310-191699332 AAGAATCACCTGAACTAGGGAGG + Intergenic
919240570 1:194910968-194910990 AAGTATTGACAGAAGGAGGAAGG - Intergenic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
919888299 1:201951022-201951044 AAGAATCACCTGAAGCTGGGAGG + Intergenic
920054256 1:203181139-203181161 GTGAGTTCCCAGAAGGAGGGAGG - Intronic
920739322 1:208565220-208565242 AAGTTTGACTAGAAGGAGGGGGG + Intergenic
921118780 1:212118817-212118839 AAGAATTACCTGAAGCAGACAGG + Intergenic
922069880 1:222181522-222181544 ATGAATTAGCAGCAGGAAGGGGG + Intergenic
922365415 1:224858796-224858818 AAGAGTTACAAGAAAGAGAGAGG + Intergenic
923621739 1:235585133-235585155 AAGGAAGACCAGAGGGAGGGAGG - Intronic
923626168 1:235615735-235615757 AAGAAGCACCAGGAGGAGGGGGG + Intronic
924461490 1:244263438-244263460 AGGAAATACCGGAGGGAGGGAGG + Intergenic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
1063998670 10:11644305-11644327 AAGAATAACCAGAAAGAGGCCGG - Intergenic
1064286431 10:13995493-13995515 AAGAATCACTAGAACGTGGGAGG + Intronic
1064635241 10:17358592-17358614 AAGAAGGAGGAGAAGGAGGGAGG + Intronic
1064961817 10:20973608-20973630 GACCATTACTAGAAGGAGGGAGG - Intronic
1065832200 10:29624446-29624468 AAGAATCACCTGAATGTGGGAGG + Intronic
1065854902 10:29822249-29822271 AAGAATTGCTAGAATCAGGGAGG - Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1067029943 10:42873206-42873228 AGGACTCACCAGCAGGAGGGAGG - Intergenic
1067840161 10:49669315-49669337 GAGAAATCCCAGAAGGAGGTGGG - Intergenic
1069587290 10:69616561-69616583 AAGAATAACCAGCAGCTGGGAGG - Intergenic
1069632420 10:69904996-69905018 GAGAATTCCCTGCAGGAGGGAGG + Intronic
1072525594 10:96268721-96268743 AGGAATTACTAGGAGGAGAGGGG - Intronic
1073379032 10:103063727-103063749 AAGAATTCCCAGAGGGAAGTAGG - Intronic
1073738731 10:106382013-106382035 AAGAATTGCTTGAACGAGGGAGG - Intergenic
1073943993 10:108730019-108730041 AGGAATAGACAGAAGGAGGGAGG + Intergenic
1074157679 10:110812568-110812590 ACGAGCGACCAGAAGGAGGGAGG + Exonic
1074251871 10:111758933-111758955 AAGAATTACAAGCAGGATTGTGG - Intergenic
1074578076 10:114689660-114689682 AAGAATTAACAGAAAAAGTGCGG - Intergenic
1074938704 10:118213720-118213742 AAGAGTTTGGAGAAGGAGGGAGG + Intergenic
1075150276 10:119923120-119923142 AAGAATTTCTAGAAGGAGACTGG + Intronic
1077517784 11:3012217-3012239 CAGAATTCCGAGAAGGAGTGCGG - Exonic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078129068 11:8596950-8596972 AAGAATTAATAGAAGAAAGGAGG + Intergenic
1079067919 11:17313697-17313719 AAGCATTTCGAGAAAGAGGGAGG - Intronic
1080144549 11:28965613-28965635 AAGACTTACCAGATGAAGGTTGG - Intergenic
1082179769 11:49103314-49103336 AAGCAGAACCAGTAGGAGGGCGG - Intergenic
1082781004 11:57287347-57287369 CAGAATTACCAGAAACGGGGTGG + Intergenic
1083185169 11:61013483-61013505 GAGAATTCCCAGAACGATGGAGG - Exonic
1084316189 11:68347232-68347254 AGGAATGTCCAGAAGCAGGGTGG + Intronic
1084373930 11:68763513-68763535 AAGAATGTCTAGCAGGAGGGCGG + Intronic
1084599404 11:70136020-70136042 AGGAACTCCCAGAAGGAGGGAGG - Intronic
1085296509 11:75434605-75434627 CTGAATTGCCAGCAGGAGGGTGG - Intergenic
1085316495 11:75548269-75548291 AAGAGATACCAGAGGCAGGGAGG + Intergenic
1086230014 11:84556948-84556970 AAGTATTACCAGCAGAATGGAGG + Intronic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086390849 11:86361204-86361226 AAGAACCACCAGAAGTAGAGAGG + Intergenic
1086404380 11:86487522-86487544 AGGAAGAACCAGAAGGTGGGAGG + Intronic
1087237470 11:95736099-95736121 AATAATTGCCAGAAGGGGTGGGG + Intergenic
1088455776 11:110031329-110031351 GTGAATCACCTGAAGGAGGGTGG - Intergenic
1089014409 11:115154614-115154636 AAGAAATACCAGAAGGGGAGCGG + Intergenic
1089643126 11:119860634-119860656 AAGATTGACCAAAAGGAAGGAGG - Intergenic
1091471856 12:735555-735577 GAGAATTACCAGAACCTGGGAGG + Intergenic
1092277798 12:7075351-7075373 AGGAAGGAACAGAAGGAGGGAGG - Intergenic
1092708726 12:11311484-11311506 AAGAAGAACCAGAAAGAAGGTGG - Intergenic
1093275000 12:17115024-17115046 AAGAATTAAAAGAAGGAGCTTGG + Intergenic
1094050027 12:26209005-26209027 AAGAATAAAATGAAGGAGGGTGG - Intronic
1094100216 12:26753555-26753577 AAGCATTGCCTGAAGCAGGGTGG - Intronic
1095266682 12:40167775-40167797 AAGAATTAACAGAAAGAGAGAGG + Intergenic
1095402474 12:41830811-41830833 AAGCAAGACCAGAGGGAGGGAGG + Intergenic
1095650581 12:44604189-44604211 AAGAAGAAAGAGAAGGAGGGAGG + Intronic
1096831522 12:54318167-54318189 AAGAAGTAACAGAAAGAGGCTGG - Intronic
1097197563 12:57251893-57251915 AAATTTTACAAGAAGGAGGGTGG - Intronic
1097267380 12:57754256-57754278 AGTAATTAACAGAAGAAGGGAGG - Intronic
1097629342 12:62040686-62040708 ATGAAGTACCAGAAGTGGGGTGG - Intronic
1097801338 12:63917789-63917811 AAGAATTACAGAAAGCAGGGTGG - Intronic
1098349892 12:69547473-69547495 AAGAATTACGAGATGGATGATGG + Intronic
1098380118 12:69860613-69860635 AAGAAGTACAAGAAGCAGAGGGG - Intronic
1099715032 12:86281148-86281170 AAAAACTACCAAAAGAAGGGAGG - Intronic
1099967839 12:89469638-89469660 ACAAATTAGCAGAAGGAGTGAGG + Intronic
1101054164 12:100895047-100895069 AACATTGACCAGAAGGAAGGTGG - Intronic
1101611947 12:106301006-106301028 CAGAATTACCAGAAGTTTGGGGG + Intronic
1101973764 12:109336964-109336986 CACACTTACTAGAAGGAGGGAGG + Intergenic
1102605782 12:114066196-114066218 AAGAGATACCACAAGGGGGGTGG + Intergenic
1103230710 12:119328194-119328216 AGGAAGTACCAGAAGGGGAGTGG + Intergenic
1103524002 12:121555460-121555482 AAGAATTACTTGAACCAGGGAGG - Intronic
1104057280 12:125240113-125240135 CAGAATCACCAGAAGGTGGAAGG - Intronic
1105309740 13:19195746-19195768 AAAAATTTTCAGAAGGAGGTCGG + Intergenic
1105795562 13:23848864-23848886 AAGAAAAGCCAGAAGGAGAGAGG + Intronic
1108451734 13:50573451-50573473 AAGAAATACTAGAGGGAGTGAGG + Intronic
1108950246 13:56083617-56083639 AGAAAATAGCAGAAGGAGGGTGG + Intergenic
1109281648 13:60363591-60363613 AAGAATTAAAACAAGGTGGGGGG + Intergenic
1110830042 13:80020238-80020260 AAGAACTACCAAAAGGTAGGAGG + Intergenic
1111166542 13:84464535-84464557 AAGAATAACTAAAAGGAGGTTGG + Intergenic
1111235640 13:85404436-85404458 AAGAACTACCAGAGACAGGGTGG - Intergenic
1112114783 13:96339902-96339924 AATTATTTCCAGAAGGAGGTGGG + Intronic
1112737051 13:102431879-102431901 AAGAAATGAGAGAAGGAGGGAGG - Intergenic
1112924552 13:104657585-104657607 AAGACTGACAGGAAGGAGGGAGG - Intergenic
1114738750 14:25071371-25071393 AAGAGTTTCAAGAAGGAAGGGGG + Intergenic
1114831050 14:26142063-26142085 AGAAAATACTAGAAGGAGGGAGG - Intergenic
1115577878 14:34728693-34728715 AATTATTACCAGAGGTAGGGGGG - Intergenic
1115591268 14:34867683-34867705 AAGACTTACCCTAAGGAGGCAGG + Intronic
1116074807 14:40097834-40097856 AAGAAGGAACGGAAGGAGGGAGG - Intergenic
1116109297 14:40556107-40556129 AAGAATTATCAGAAGGATTTGGG + Intergenic
1116693893 14:48148025-48148047 AAAAATCACCAGAAGGAGATAGG - Intergenic
1116836098 14:49769963-49769985 GAGAATTGCAAGAAGGGGGGCGG + Intronic
1117697896 14:58384738-58384760 AAGAAATACCTGAAGGTAGGGGG + Intergenic
1118348073 14:64954230-64954252 AAGAGTGAAGAGAAGGAGGGAGG + Intronic
1118505067 14:66402327-66402349 AGGAATTAAGAGAAGGAAGGTGG - Intergenic
1118852795 14:69597274-69597296 AAGAATCACTTGAAGCAGGGAGG + Intergenic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1120677197 14:87434219-87434241 AAGAATTTCCTGAAGCAGTGGGG + Intergenic
1121380675 14:93463175-93463197 GAGAGTTTCAAGAAGGAGGGAGG + Intronic
1121624573 14:95374805-95374827 AAGAAAGAAAAGAAGGAGGGAGG - Intergenic
1124021980 15:25933618-25933640 AAGTGTTACCTGAAGGACGGTGG + Intergenic
1124040178 15:26094762-26094784 AAGAATTGCCTGCAGCAGGGTGG + Intergenic
1124827524 15:33113663-33113685 GAGAAGTAACAGAAGGTGGGTGG - Intronic
1125755495 15:42061500-42061522 AAAAATTAGCAGATGGTGGGGGG + Intergenic
1126380459 15:48041452-48041474 AAGAATTTCTTGAAAGAGGGTGG - Intergenic
1126674817 15:51151732-51151754 AAGAACTACTAGAGGGAGGAGGG + Intergenic
1126853568 15:52815439-52815461 TGGAATCAGCAGAAGGAGGGTGG - Intergenic
1126872304 15:53002611-53002633 AAGTGGTACCAGAAGGAGAGTGG - Intergenic
1127214450 15:56809968-56809990 ATGAAGTACCACAAGGTGGGTGG + Intronic
1127286142 15:57535436-57535458 AAGAATTACTGGAAAGAGGGTGG + Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1128619744 15:69138636-69138658 ATGAATTAACAGAAGGAAGGAGG + Intergenic
1128690888 15:69723999-69724021 CAGAATTACAAGGTGGAGGGTGG + Intergenic
1129590168 15:76907698-76907720 AAGTATTTCCAGAAGGAAGGAGG - Intergenic
1130172701 15:81532202-81532224 AAGAATGACAAGAATGCGGGAGG + Intergenic
1130773240 15:86946549-86946571 AAGAAATACCATGAGGAGGTTGG + Intronic
1132023503 15:98384918-98384940 AGGAAGGACAAGAAGGAGGGAGG + Intergenic
1133268003 16:4596127-4596149 ACAAATTACCACAAGCAGGGTGG + Intronic
1134567886 16:15266708-15266730 AAGGATTGGCAGAGGGAGGGCGG - Intergenic
1134734549 16:16489645-16489667 AAGGATTGGCAGAGGGAGGGCGG + Intergenic
1134823958 16:17269708-17269730 AAGAATTACCAAAAGCAGGAAGG - Intronic
1134932917 16:18222261-18222283 AAGGATTGGCAGAGGGAGGGCGG - Intergenic
1135142500 16:19933758-19933780 AAGCATTCCCAGAAGAAGGGAGG - Intergenic
1135806462 16:25547268-25547290 AAGAAGGGCCAGATGGAGGGAGG - Intergenic
1138248952 16:55487862-55487884 AAGAATGAAGAGGAGGAGGGAGG - Intronic
1138529568 16:57627837-57627859 AGGAATGACCAGAAGGGGGATGG + Intronic
1138835853 16:60434167-60434189 AAGAATTGCCTGAACCAGGGAGG - Intergenic
1139001158 16:62511827-62511849 AAGGATTACCTGAAGCTGGGTGG + Intergenic
1139412319 16:66773967-66773989 AAGAATTACTTGAACCAGGGAGG - Intronic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139775471 16:69314291-69314313 TAGAATTTCCAAAAGGAGGGAGG + Intronic
1140280667 16:73552240-73552262 AAAAATTACCGAAAGCAGGGTGG - Intergenic
1140418597 16:74797020-74797042 TTGAATTCCCAGAGGGAGGGAGG + Intergenic
1140694810 16:77522111-77522133 AAGAAATACCAGTAGAAGTGTGG - Intergenic
1141776225 16:86124190-86124212 AAGAATTACTTGAAGTCGGGAGG + Intergenic
1142525350 17:536314-536336 AAAAAATACCAGGGGGAGGGAGG + Intronic
1142642479 17:1292444-1292466 GAGCAGCACCAGAAGGAGGGTGG - Intronic
1143738197 17:8929442-8929464 GAGAATTACCAGAAGCAGAGAGG + Intronic
1147901593 17:43789824-43789846 ATAAATTAACAGAAGGAGGCTGG - Intergenic
1149892801 17:60405073-60405095 AAGAATTGCCTGAACCAGGGAGG + Intronic
1150229059 17:63539947-63539969 ATGAAGTACCAGGGGGAGGGTGG - Intronic
1150573777 17:66411857-66411879 AAAAATTACCAGAAAGTAGGCGG - Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1153558988 18:6351104-6351126 AAGAATCACTTGAACGAGGGAGG + Intronic
1153805017 18:8704122-8704144 AATAATTACAAGGAGGAGGGCGG - Intergenic
1154385796 18:13890788-13890810 AAGAAATTCCAGAAGGAGACCGG - Intronic
1155999766 18:32371719-32371741 ACCAAGTACCACAAGGAGGGTGG + Intronic
1156218677 18:35028682-35028704 AATAATTTCCCGAAAGAGGGAGG + Intronic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1158181310 18:54717734-54717756 AAGAATCACCAGAAACAGGGAGG + Intergenic
1159254028 18:65922077-65922099 GTGAACTACCAGAAGGAGGAGGG - Intergenic
1159440155 18:68468080-68468102 ATGAATTAACACATGGAGGGTGG + Intergenic
1160041259 18:75347746-75347768 AAGAATGAAGAGAGGGAGGGAGG + Intergenic
1161711407 19:5850611-5850633 AAGAATTGCTTGAACGAGGGAGG + Intronic
1162228262 19:9242915-9242937 AAGAAAGACAAGAAGGAAGGAGG - Intergenic
1162268460 19:9595238-9595260 AAGAGGTACCACAAGGAGTGGGG - Intergenic
1162839235 19:13343418-13343440 AAGAAAGACCAGAAGGAGGCTGG - Intronic
1164726193 19:30467562-30467584 ATGAATGACGACAAGGAGGGTGG + Intronic
925145911 2:1583272-1583294 AAGAGTGACCAGCGGGAGGGAGG - Intergenic
926570141 2:14520588-14520610 AAGAATTCCCGGCAGGGGGGTGG - Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
927329371 2:21843851-21843873 AGGAATTAAGAGAAAGAGGGTGG - Intergenic
927648605 2:24897308-24897330 AAGAAGTCCCAGAAAGAGAGAGG - Intronic
927773078 2:25880491-25880513 AAGGAAATCCAGAAGGAGGGTGG - Intergenic
928171688 2:29008544-29008566 AAGAATTACTAGAACCAGGGAGG - Intronic
928251565 2:29685720-29685742 ACAAATTACCAGAAAGTGGGGGG + Intronic
929113913 2:38428485-38428507 AAAAAATAGAAGAAGGAGGGTGG - Intergenic
929793973 2:45044332-45044354 AAGAATTACCAGAAGGAGAATGG - Intergenic
931084954 2:58819582-58819604 AAAATTTAACAGAAGGAGAGAGG - Intergenic
932576640 2:72965891-72965913 GAGAACTACAAGAAGGCGGGGGG - Intronic
932993133 2:76812794-76812816 AAGAATAAGGAGGAGGAGGGGGG - Intronic
938428399 2:131210507-131210529 AAGAGTTACCCGAAGGAGCAAGG - Intronic
940124774 2:150311163-150311185 GAGAACTAGCAGAAGCAGGGTGG + Intergenic
940342014 2:152591303-152591325 AAATATTACCAGAGGGAGGCCGG - Intronic
941425084 2:165333203-165333225 TACCATTACCAGAAGGAGGATGG + Intronic
943329892 2:186546574-186546596 AGAAATTACCAGAAATAGGGTGG - Intergenic
943561794 2:189472920-189472942 AAGAAATATCATAAGGAGGCCGG + Intronic
943954712 2:194174379-194174401 GAGAATTACCTGAACCAGGGAGG - Intergenic
945295279 2:208164488-208164510 AAGCAATGCTAGAAGGAGGGTGG - Intergenic
945369505 2:208999598-208999620 AGAAATTTCTAGAAGGAGGGTGG - Intergenic
945825330 2:214714529-214714551 AAGAATTACTACAAAGAGGATGG + Intergenic
947189461 2:227487119-227487141 AGAAATTAACAGAAGGAGGGCGG - Intronic
947556590 2:231098868-231098890 AAGAGGTACCACAAGGAAGGGGG - Intronic
948030205 2:234811492-234811514 AAGAAAAACCAGAAGAAGAGTGG - Intergenic
1168752491 20:292714-292736 GAGAATTACTTGAAGCAGGGAGG + Intergenic
1169066528 20:2697152-2697174 AAGATTTTACAGAAGGTGGGTGG + Intronic
1169472247 20:5896692-5896714 AGGAAATCCCTGAAGGAGGGAGG + Intergenic
1170407362 20:16052435-16052457 AAGAGTTACAGGAGGGAGGGAGG + Exonic
1171122856 20:22581095-22581117 AATTATTTCAAGAAGGAGGGAGG - Exonic
1171962398 20:31504167-31504189 AAACATTCCCAGTAGGAGGGTGG - Intergenic
1172334885 20:34107027-34107049 AAAAATTAGCAGAAGGTGGCGGG + Intronic
1173122020 20:40302157-40302179 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1175011812 20:55745206-55745228 GAGAATTACCAACAGGAGGTGGG + Intergenic
1177032813 21:16003673-16003695 AATAATTAACATAAAGAGGGCGG - Intergenic
1177116246 21:17090496-17090518 AAGATTTACAAGTTGGAGGGGGG + Intergenic
1178213149 21:30560665-30560687 AAGAATGACGAGGAGGAGGAGGG + Intronic
1178417409 21:32415036-32415058 AGGAATTTGCAGAGGGAGGGCGG - Intronic
1180897408 22:19346909-19346931 AAGAATAATCAGCAGGAAGGAGG + Intronic
1182471244 22:30549646-30549668 AAGGAAGACAAGAAGGAGGGGGG - Intergenic
1182601393 22:31467526-31467548 AAGAATTGCCAGAACTAGGCCGG + Intronic
1182719137 22:32383740-32383762 AAGAATTTCAAGAAGAAGTGAGG - Intergenic
1183128527 22:35809605-35809627 AAGTATTTCTAGGAGGAGGGAGG + Intronic
1183881477 22:40835065-40835087 AAAAATTAGGAGAAGGCGGGGGG - Intronic
1184002113 22:41682593-41682615 AAGAATTAGGTGAAGGATGGAGG + Intronic
1184991158 22:48170868-48170890 AAGAATGAAGAGAAGGAGAGAGG - Intergenic
1185021631 22:48380015-48380037 AGGAGGTACCAGAAGGAGGGTGG + Intergenic
949335131 3:2966465-2966487 AACAATTACCAGAAGGAGGGAGG + Intronic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950787729 3:15450065-15450087 CAGCATTGCCAGATGGAGGGAGG - Intronic
950968687 3:17164853-17164875 AAGATTTCCCTGAAGGAGAGAGG + Intronic
951219050 3:20050439-20050461 AAGGATTACCAGGAGTGGGGAGG - Intronic
951533097 3:23716652-23716674 GAGAATTACTAGAACGTGGGAGG + Intergenic
952238854 3:31509184-31509206 AAGAAATAAAAGAAGGAAGGAGG + Intergenic
952382257 3:32814812-32814834 GAGAATTGCCAGAAGGAAGATGG - Intergenic
952488473 3:33841115-33841137 AAGAATCACCTGAAGCCGGGAGG - Intronic
952608152 3:35174102-35174124 AAGAGTGAGCAGAAGCAGGGTGG - Intergenic
952647621 3:35680777-35680799 AAGAAGAAAGAGAAGGAGGGAGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
956841653 3:73145703-73145725 AAGAATTGCCTGAACCAGGGAGG - Intergenic
956969627 3:74507719-74507741 AAGAATTGCTAGAAGCCGGGAGG - Intronic
957842754 3:85692931-85692953 AAGAAAAATCAGAAGGAGGCCGG + Intronic
962620668 3:137174902-137174924 AGGATTTACCTGAAGGAGGCAGG - Intergenic
962769689 3:138600901-138600923 AAGAAGGAGGAGAAGGAGGGAGG + Intergenic
962982814 3:140506302-140506324 AAGAATGGGCAGAAGGAGGGAGG - Intronic
963567625 3:146949193-146949215 AGGAATTGCTAGAACGAGGGAGG - Intergenic
963958719 3:151284696-151284718 AAGAATCACCAGAACCCGGGAGG - Intronic
965587653 3:170333232-170333254 AAAAATTATCAGAAGGTGAGAGG + Intergenic
965881614 3:173395414-173395436 GAGATTTACCAAAAAGAGGGGGG + Intergenic
967315628 3:188149877-188149899 GAAAACTACTAGAAGGAGGGTGG + Intergenic
967533710 3:190578046-190578068 GAGAACTACCAGAGGGAGGTGGG + Intronic
968120001 3:196119528-196119550 AAGAATGATTAGAAGGAGGCTGG + Intergenic
969255075 4:5995959-5995981 AAGAAGAACCTGAAGGAGGTAGG - Intergenic
969971395 4:11052050-11052072 AAGAATGAACAGAACGAGGTAGG - Intergenic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
970994580 4:22250642-22250664 AAGAATAACCAGAAGCAGGTTGG - Intergenic
973682669 4:53337064-53337086 AAAAATTACCACAAACAGGGTGG + Intronic
973826670 4:54714443-54714465 AAGAAATACTAGATGGAGTGGGG - Intronic
973834536 4:54796053-54796075 CAGAATTGCTAGAAGTAGGGGGG - Intergenic
973868224 4:55136311-55136333 ACCAATTACCAGAAGCAGGAAGG + Intergenic
974524636 4:63033070-63033092 AAGGATTACAAGAAGAAGGTAGG + Intergenic
974887360 4:67836163-67836185 AAGTAGTACCAAAAGGAGTGAGG - Intronic
975382125 4:73713078-73713100 AAGAATAGCTAGAAGGAGAGAGG + Intergenic
976703530 4:87997264-87997286 AAGAACTACCAGAAAGAAGCAGG - Intergenic
977310298 4:95377982-95378004 AATAATTATTGGAAGGAGGGTGG - Intronic
978313902 4:107414925-107414947 AAGAGGTACCACAAGGAGGGGGG + Intergenic
978622006 4:110641866-110641888 AAGAATAAGCAAAAGGAAGGAGG - Intronic
979117157 4:116840140-116840162 AACAATTACCAAAACGAGAGTGG + Intergenic
980613894 4:135193992-135194014 AATTGTTACCAGGAGGAGGGTGG + Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
981370837 4:143956965-143956987 AAGAATCACCAGAACCTGGGAGG - Intergenic
982067530 4:151667610-151667632 AAGAATGACCAGGAGAAGGTGGG + Intergenic
982583638 4:157209823-157209845 AAGAATTGCCAGCAGAGGGGAGG - Intronic
983111059 4:163749977-163749999 AAGAATTACTTGAACGTGGGAGG + Intronic
983188963 4:164734328-164734350 AAAAATTACTAGAAGCATGGAGG + Intergenic
983531022 4:168809940-168809962 AAGTGTTAATAGAAGGAGGGTGG + Intronic
984174390 4:176398080-176398102 AAGAATTTCAAGTAGGAGAGCGG - Intergenic
984375121 4:178920759-178920781 GAGAATTACTTGAAGCAGGGAGG - Intergenic
984568340 4:181358675-181358697 AAGATTAACCAGTAGGTGGGAGG - Intergenic
985000652 4:185479188-185479210 AATAATTACAATAAGGAAGGAGG - Intergenic
985524088 5:392975-392997 AAGAATCACAAGAAGTAGGTGGG - Intronic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
985931728 5:3063722-3063744 AAGATTTTCTAGAATGAGGGAGG + Intergenic
986062487 5:4204732-4204754 AGGAATTAAAACAAGGAGGGGGG - Intergenic
986077923 5:4357194-4357216 AAAAAACACCAGAAGGTGGGAGG - Intergenic
986398136 5:7351074-7351096 AACAATTGAGAGAAGGAGGGAGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987065123 5:14282150-14282172 AAGAAATACCAGAAGAAGAAAGG - Intronic
987290773 5:16505999-16506021 AAGATAAACCACAAGGAGGGGGG + Intronic
987539553 5:19236424-19236446 TTGGATTACCAGAGGGAGGGGGG + Intergenic
987658378 5:20838751-20838773 AAAAATTACCAGAAACTGGGTGG + Intergenic
988677451 5:33447153-33447175 AAGAATGGAAAGAAGGAGGGAGG + Intronic
988765307 5:34367192-34367214 AAAAATTACCAGAAACTGGGTGG - Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989615651 5:43334805-43334827 AAGAGGTACCACAAGGAGGGGGG - Intergenic
989784055 5:45305744-45305766 AAGAAGAAACAGAAGAAGGGAGG + Intronic
990363963 5:55050308-55050330 CAGGATTACTAGAAGAAGGGAGG - Intergenic
993434098 5:87870218-87870240 AAGAATTGCCTGAATGAAGGTGG + Intergenic
994091460 5:95813033-95813055 AAGAATTACTAGAACCTGGGAGG - Intronic
996598299 5:125230520-125230542 AAGAACTACAAGAAGGGGGAGGG - Intergenic
997603934 5:135159672-135159694 AAGGTTTACTAGAAGGAGGGTGG - Intronic
998123129 5:139595981-139596003 GAGAATTGCCTGAACGAGGGAGG - Intronic
999112828 5:149136993-149137015 AAGAATGACCATCAGGAAGGAGG + Intergenic
999152661 5:149436640-149436662 AAGACCTGGCAGAAGGAGGGCGG + Intergenic
999340873 5:150770524-150770546 AAGAATCACTTGAAGCAGGGAGG + Intergenic
999411614 5:151354898-151354920 AATAATTACCAGAAAAAAGGAGG + Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
1001123305 5:168997434-168997456 TAGAATTAACTGAAAGAGGGAGG + Intronic
1002119660 5:176992714-176992736 AAGAATCACCTGAACCAGGGAGG + Intronic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1003314044 6:4995502-4995524 AAGACCTCCCAGAATGAGGGTGG - Intronic
1003358694 6:5402103-5402125 AAAAACAACCAGAAGGAGGATGG - Intronic
1003519860 6:6849300-6849322 AAGAATTACCTGAACCTGGGAGG - Intergenic
1003614293 6:7641389-7641411 AAGAACTACCAGCAGGAGTAGGG + Intergenic
1004288548 6:14345738-14345760 TAGAGTTTCCAGAAGGAAGGAGG + Intergenic
1004446200 6:15701137-15701159 AAGCATGAATAGAAGGAGGGAGG + Intergenic
1004884022 6:20034844-20034866 CAGAATTTCCAAAAGGAGGGAGG + Intergenic
1005136750 6:22577618-22577640 AAGCATTGCCACAAGGAAGGGGG + Intergenic
1005458823 6:26047995-26048017 AAGAAATACCAGAAGGAGAAAGG + Intergenic
1005974008 6:30783452-30783474 AAGAATTGCCTGAACGCGGGAGG + Intergenic
1007388171 6:41533376-41533398 GAGAATCACCAGAACCAGGGAGG + Intergenic
1007769314 6:44180414-44180436 AAGAGTTACCAGGGGGAGGGAGG - Intronic
1008904067 6:56657043-56657065 ACGAATCACCTGAGGGAGGGGGG - Intronic
1009326336 6:62352880-62352902 AAGAATTACCAGAATGAAAGTGG - Intergenic
1009882212 6:69582975-69582997 AAGAATTACTAGAAGGATATTGG + Intergenic
1010327692 6:74583998-74584020 AAAAATGATCAGAAGGAGGAAGG + Intergenic
1011139404 6:84135771-84135793 AAGAATCACTTGAATGAGGGAGG + Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013598656 6:111684128-111684150 AAGAAGTTTGAGAAGGAGGGAGG + Intronic
1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG + Exonic
1013862365 6:114651160-114651182 AAAAATTATAGGAAGGAGGGAGG - Intergenic
1018008903 6:159649840-159649862 AGCAAGTACCAGAAAGAGGGAGG + Intergenic
1018034272 6:159867931-159867953 AAGAATTACCTCAAGCTGGGTGG - Intergenic
1018342958 6:162870883-162870905 AAGAAACAAGAGAAGGAGGGAGG - Intronic
1018371132 6:163169649-163169671 AGGAATTAGCAGGAGGAGTGTGG + Intronic
1019068580 6:169323275-169323297 ATGAAATACCAGAAGTTGGGTGG + Intergenic
1019617448 7:1971862-1971884 AACAATTTCCGGAAGCAGGGAGG + Intronic
1019943406 7:4308568-4308590 AGAAATTACCACAAGGGGGGGGG - Intergenic
1020989407 7:15178711-15178733 AGTAAATACCAGAAGGAAGGAGG + Intergenic
1021103324 7:16608560-16608582 CAGATTTGCCAGAGGGAGGGAGG + Intronic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021584435 7:22193021-22193043 AAGAAATACAAGGAGGAGGAGGG - Intronic
1021862209 7:24917019-24917041 AAGAATTCCCAGGAGTAGAGGGG + Intronic
1022479561 7:30734034-30734056 AAGCATGACCACAAGGAAGGAGG - Intronic
1023049964 7:36242433-36242455 ATGAATGAACAGAAGGAAGGAGG - Intronic
1023258315 7:38334273-38334295 AGGAAGTAAGAGAAGGAGGGAGG + Intergenic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1023798815 7:43815239-43815261 AAGAGTTACCACAAGGAGGGGGG + Intergenic
1026360174 7:69596935-69596957 TAGTATTACTGGAAGGAGGGTGG - Intergenic
1027628175 7:80569947-80569969 AATAATTACCAAAAGCTGGGAGG - Intronic
1029107173 7:98187698-98187720 AAGAATTACTTGAACCAGGGAGG - Intronic
1033068557 7:138180198-138180220 AATAAGTGACAGAAGGAGGGAGG + Intergenic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1035055954 7:156036851-156036873 AAGATTTGGCAGAAGGAGTGGGG + Intergenic
1035333820 7:158113132-158113154 AAGAATTCCAAGAAGGAGAAGGG + Intronic
1035862056 8:3039478-3039500 AAGAATTGAAAGAAGGAAGGAGG - Intronic
1036607253 8:10318386-10318408 AGGAATAACCAGGACGAGGGAGG - Intronic
1036619054 8:10410987-10411009 AGGAAAGACGAGAAGGAGGGAGG - Intronic
1036708439 8:11061771-11061793 AAGAATGAGAAGAAGGAAGGGGG + Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1038696868 8:29813952-29813974 TAGGATTACCTGAAGGATGGTGG + Intergenic
1040816975 8:51519243-51519265 AAGAATTTCCTGAAGAAGGCCGG + Intronic
1041903584 8:63008214-63008236 TAGAGTTTCCAGGAGGAGGGGGG - Intergenic
1042426002 8:68649666-68649688 AACAGCTACCAGAAGGAGTGAGG - Intronic
1042732232 8:71948778-71948800 AAGAATGAAAAGAAGGAAGGGGG + Intronic
1044014393 8:87032885-87032907 AAGAATTAACAGAAGATGGGAGG - Intronic
1044319705 8:90788952-90788974 AAAAACCACGAGAAGGAGGGGGG - Intronic
1045737952 8:105318584-105318606 AAGAAGGAAGAGAAGGAGGGAGG - Intronic
1045974845 8:108120659-108120681 AAGAATTGCCAGAGGGTGGATGG - Intergenic
1046222858 8:111238035-111238057 AACAATTACTAGAAGGAGACAGG + Intergenic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1046764071 8:118050869-118050891 AAGAATTAGAAGGTGGAGGGAGG + Intronic
1046874837 8:119242601-119242623 AAAAATCAGCAGAAGAAGGGTGG + Intronic
1046921249 8:119731832-119731854 AAGAATTATAAAAGGGAGGGGGG - Exonic
1047259669 8:123244292-123244314 AAGAATTACAGGAAAGAAGGAGG - Intronic
1047477545 8:125248561-125248583 GAGAATTACCTGAACCAGGGAGG + Intronic
1051350302 9:16192474-16192496 AAGAGATAGGAGAAGGAGGGAGG - Intergenic
1054706950 9:68472348-68472370 AAGAATAACCAGGAGGGGGTTGG - Intronic
1054749009 9:68885673-68885695 AAGACTTAGAAGAGGGAGGGTGG + Intronic
1055608013 9:77991551-77991573 AAGATTTTTAAGAAGGAGGGAGG - Intronic
1055658142 9:78472921-78472943 GAGGATTTCCAGAAGGAAGGTGG + Intergenic
1056935955 9:90914846-90914868 AAACATTACCAGAAGGACAGAGG + Intergenic
1058009215 9:99957741-99957763 AAGAATTACTAGAACCTGGGAGG - Intronic
1058413459 9:104760860-104760882 AAGTATTAGCTGAAGGATGGTGG - Intergenic
1059014354 9:110498343-110498365 AAGGAGTTCCAGAAGGAGAGAGG - Intronic
1059770539 9:117419787-117419809 AAGAATTGACAGACGGAGGATGG - Intergenic
1060501669 9:124161933-124161955 ATGGAATACCAGAAGGAGAGGGG - Intergenic
1061352532 9:130076975-130076997 AAGAATCACTTGAACGAGGGAGG - Intronic
1061541104 9:131278124-131278146 AGGGATTACCAGGGGGAGGGCGG - Intergenic
1185803614 X:3035807-3035829 AAGAAATAGCAGAATGGGGGCGG - Intergenic
1186264560 X:7818535-7818557 AAGAAGGAGGAGAAGGAGGGCGG + Intergenic
1186312040 X:8331119-8331141 AAGACATAGCACAAGGAGGGAGG + Intergenic
1188056507 X:25547377-25547399 AAGATGTACCACAAGGAGTGAGG - Intergenic
1188578854 X:31685997-31686019 AGGAAGTACCAGTAGGAGAGTGG - Intronic
1188669120 X:32861595-32861617 AAGAATGAAAAGAAGGAGAGTGG + Intronic
1189764521 X:44356803-44356825 AAGAATCACCTGAACCAGGGAGG - Intergenic
1189834292 X:45005026-45005048 AAGAGGTACCATAAGGAGGGGGG - Intronic
1194693907 X:97021357-97021379 AAAAATTACCAAAAGGAGCAGGG - Intronic
1194798624 X:98242856-98242878 AAGAATGACCAGAATGGGGGAGG + Intergenic
1195366699 X:104133557-104133579 AATAGTAACCAGAAGCAGGGAGG - Intronic
1195478297 X:105313575-105313597 AAGAATAAACAAATGGAGGGGGG - Intronic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1196106192 X:111898521-111898543 AAGAAATAATGGAAGGAGGGAGG - Intronic
1196329488 X:114453753-114453775 AAGAACTAGAAGAAGGAGGGAGG + Intergenic
1196441166 X:115721428-115721450 GGGAATTACCAGGAGGTGGGGGG - Intergenic
1196444694 X:115839416-115839438 GGGAATTACCAGGAGGTGGGGGG - Intergenic
1196706487 X:118721732-118721754 AAGGATGACCAGAATGAGAGAGG - Intergenic
1197005846 X:121496590-121496612 AACAATTACTAGAAGTAGTGAGG - Intergenic
1197895269 X:131306262-131306284 AAAAATTTCCAAAATGAGGGAGG - Intronic
1198106487 X:133466907-133466929 AAGAATTGCCTGAACTAGGGAGG - Intergenic
1198386455 X:136133671-136133693 AAGAATTACTTGAAACAGGGAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199316349 X:146382737-146382759 TAGAAGTCCCAGAGGGAGGGAGG + Intergenic
1199637467 X:149826914-149826936 AAGAGGTACCACAAGGAGGGTGG + Intergenic
1201274757 Y:12286892-12286914 AGGAATTGTCAGAAGGAAGGGGG + Intergenic
1201317224 Y:12659539-12659561 AAGAGTTAACGGAAGGCGGGTGG + Intergenic