ID: 1046654028

View in Genome Browser
Species Human (GRCh38)
Location 8:116874127-116874149
Sequence GGCGGAAGGTTGCTGCTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 123}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046654009_1046654028 29 Left 1046654009 8:116874075-116874097 CCCCGCCCAGCCCCACCAGCTCC 0: 1
1: 2
2: 21
3: 169
4: 1579
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654017_1046654028 14 Left 1046654017 8:116874090-116874112 CCAGCTCCGCACTTTCTTGAGCC 0: 1
1: 0
2: 0
3: 10
4: 105
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654015_1046654028 18 Left 1046654015 8:116874086-116874108 CCCACCAGCTCCGCACTTTCTTG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654010_1046654028 28 Left 1046654010 8:116874076-116874098 CCCGCCCAGCCCCACCAGCTCCG 0: 1
1: 0
2: 10
3: 94
4: 872
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654014_1046654028 19 Left 1046654014 8:116874085-116874107 CCCCACCAGCTCCGCACTTTCTT 0: 1
1: 0
2: 3
3: 14
4: 228
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654011_1046654028 27 Left 1046654011 8:116874077-116874099 CCGCCCAGCCCCACCAGCTCCGC 0: 1
1: 0
2: 5
3: 112
4: 887
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654018_1046654028 8 Left 1046654018 8:116874096-116874118 CCGCACTTTCTTGAGCCCCGCAC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654021_1046654028 -7 Left 1046654021 8:116874111-116874133 CCCCGCACCCGAGTTCGGCGGAA 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654016_1046654028 17 Left 1046654016 8:116874087-116874109 CCACCAGCTCCGCACTTTCTTGA 0: 1
1: 0
2: 2
3: 8
4: 153
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654013_1046654028 23 Left 1046654013 8:116874081-116874103 CCAGCCCCACCAGCTCCGCACTT 0: 1
1: 0
2: 2
3: 26
4: 268
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654022_1046654028 -8 Left 1046654022 8:116874112-116874134 CCCGCACCCGAGTTCGGCGGAAG 0: 1
1: 0
2: 0
3: 0
4: 24
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654023_1046654028 -9 Left 1046654023 8:116874113-116874135 CCGCACCCGAGTTCGGCGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123
1046654012_1046654028 24 Left 1046654012 8:116874080-116874102 CCCAGCCCCACCAGCTCCGCACT 0: 1
1: 0
2: 3
3: 31
4: 279
Right 1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046654028 Original CRISPR GGCGGAAGGTTGCTGCTCCC GGG Intronic
900165370 1:1242351-1242373 GGCAGAAGGGTGCTGTTCACAGG - Intergenic
900905857 1:5556904-5556926 GGCTGAAGGGTGCAGCTGCCTGG + Intergenic
902802387 1:18838498-18838520 GGGGGAAGGCTCCAGCTCCCCGG - Intergenic
903522181 1:23959368-23959390 GGCGGGAGGGGGCTGCGCCCTGG + Intronic
904591593 1:31618162-31618184 GCCGGAGGGTTGCGGATCCCTGG - Intronic
906757215 1:48330055-48330077 GGAGCAATGTTACTGCTCCCTGG - Intronic
915475104 1:156148592-156148614 GGCGGAGCCATGCTGCTCCCAGG + Intronic
916088666 1:161290002-161290024 GGTAGAAGGATTCTGCTCCCTGG + Intergenic
920695092 1:208175738-208175760 GGCCTCAGGTTGTTGCTCCCTGG - Intronic
921325014 1:213980704-213980726 CGTGGAAGGTTCCTGCTCTCTGG - Intergenic
921861443 1:220046263-220046285 CGTGGAAGGTCGCTGCGCCCCGG - Intronic
922771983 1:228190372-228190394 GGGAGAACGTGGCTGCTCCCTGG - Intergenic
1063117409 10:3081453-3081475 GGAGGAAGCTTGGTGCTCTCAGG + Intronic
1065965306 10:30765995-30766017 GGCTGAAGTTTGGTTCTCCCTGG - Intergenic
1072913225 10:99521760-99521782 GGTGGAGGCTGGCTGCTCCCGGG - Intergenic
1074143236 10:110695380-110695402 GTCGGAAGGTGGCTCCTGCCTGG + Intronic
1074998731 10:118779600-118779622 GGTGGAAGGTGGCTGCCTCCAGG - Intergenic
1075280166 10:121132207-121132229 GTCTGAGGGGTGCTGCTCCCTGG + Intergenic
1075454681 10:122577517-122577539 GGTGGCTGTTTGCTGCTCCCTGG + Intronic
1076646953 10:131960342-131960364 GGTGGAGGTTTGCTGCTCTCTGG + Intergenic
1077693874 11:4375684-4375706 GGCTGAAGTTTGATGATCCCTGG + Intergenic
1083716689 11:64581502-64581524 GCCTGAAGGCTGCTGATCCCTGG - Intergenic
1084774952 11:71369013-71369035 GCCGGCAGGCTGCTGCTCCAGGG + Intergenic
1084962933 11:72726752-72726774 GGCGGAAGGCAGCTCCTCCGGGG + Exonic
1086883839 11:92180713-92180735 GGGGGAAGGTCGCAGCTCCATGG - Intergenic
1088835399 11:113574392-113574414 GTCTGAAGGGGGCTGCTCCCAGG - Intergenic
1090848215 11:130547518-130547540 GGCTGGAGGCTGCTGCTCCCAGG + Intergenic
1103078589 12:118005321-118005343 GTGTGAAGGCTGCTGCTCCCTGG + Intergenic
1103241329 12:119415902-119415924 GGCTGTAGTTTGCTGATCCCTGG + Intronic
1106520570 13:30493884-30493906 GGGGGAGGGTTGCTGAGCCCAGG + Intronic
1113813549 13:113156492-113156514 GGAGGAATGTGGGTGCTCCCTGG - Intergenic
1114866313 14:26598404-26598426 GGTGAAAGGTCGCTGGTCCCCGG + Intergenic
1114912444 14:27218073-27218095 GGAGGAAGGTTGGGGCTTCCAGG + Intergenic
1118362591 14:65068994-65069016 GCTGCAAGGGTGCTGCTCCCAGG + Intronic
1119420448 14:74505031-74505053 GGCTGAATGCTGCTGCACCCAGG - Exonic
1121633739 14:95439827-95439849 GGAGGGAGGTTTCTGCTCCTTGG + Intronic
1121803574 14:96795661-96795683 AGCTGAAGGTCACTGCTCCCTGG - Intergenic
1121823687 14:96992892-96992914 GAGGGAAGGTGGCTGTTCCCTGG - Intergenic
1122902298 14:104786920-104786942 GCGGGGAGGTGGCTGCTCCCTGG - Intronic
1132145318 15:99425883-99425905 GGAGGAAGGAAGCCGCTCCCTGG + Intergenic
1132701039 16:1222236-1222258 GGCTGAAGGATGCTGCCCCCGGG + Exonic
1132789272 16:1676241-1676263 GGCTGCAGTTGGCTGCTCCCAGG - Exonic
1132893324 16:2215090-2215112 GGCGCAAGGCCGCTGTTCCCGGG + Intergenic
1140455030 16:75100007-75100029 TGTGGAAGAATGCTGCTCCCTGG + Intronic
1141416900 16:83882723-83882745 AGCGGCAGGTGGCTGATCCCTGG - Intergenic
1141771097 16:86090052-86090074 CAGGGAAGGTTGTTGCTCCCTGG + Intergenic
1142307618 16:89294326-89294348 GGTGAAAAGTTGCTGCTTCCTGG - Intronic
1143479386 17:7219851-7219873 GGCGGACGGTTGCGGGCCCCGGG - Intronic
1144275916 17:13667931-13667953 GGAGGGAGGTTGCTGCTGCCGGG + Intergenic
1144275980 17:13668268-13668290 GGAGGGAGGTTGATGCTGCCAGG - Intergenic
1146839313 17:36138855-36138877 GGCTGTAGTTTGCTGATCCCCGG - Intergenic
1147894192 17:43739924-43739946 GGTGGGAGGTGGCTTCTCCCAGG - Intergenic
1150217266 17:63477544-63477566 GGATGAGGGTGGCTGCTCCCAGG + Intergenic
1151547315 17:74801061-74801083 GGGGGAAGGGTGTTGCTTCCAGG + Intronic
1155216513 18:23648019-23648041 GGGGGAAGGGAGCGGCTCCCAGG + Intronic
1156449038 18:37256172-37256194 CTCAGAAGGTTTCTGCTCCCAGG + Intronic
1158758333 18:60353369-60353391 GGCTGTTGGTTGCTGCTCCAGGG - Intergenic
1159577164 18:70193357-70193379 GGCCGAGGGCTGCTGCTTCCTGG + Exonic
1159797616 18:72863815-72863837 GGGGGAAGGTGGGTGCTTCCAGG + Intronic
1167301797 19:48681991-48682013 GGGGTCAGGTTGCTGCTTCCAGG - Intergenic
925052949 2:831280-831302 GGGTGGAGGTTGCAGCTCCCAGG - Intergenic
925742680 2:7019606-7019628 GGCAGAGCCTTGCTGCTCCCTGG + Intronic
926087502 2:10029306-10029328 GGCGGGAGCTTCTTGCTCCCTGG + Intergenic
926675725 2:15618661-15618683 GGCGGAAGGGGGCTAGTCCCCGG - Intronic
927697387 2:25247536-25247558 GGGGGAAGGTTCTTGATCCCAGG - Intronic
937049155 2:118874424-118874446 GGCTGAGGGTTGCTCCTTCCTGG - Intergenic
939782463 2:146465530-146465552 GGAGGAATCTTACTGCTCCCAGG + Intergenic
947978404 2:234387184-234387206 GGTGCAAGGATGCTGCTGCCAGG + Intergenic
948565706 2:238884802-238884824 GCCGGAAAGTGCCTGCTCCCTGG + Intronic
948673544 2:239583992-239584014 GGCTGAAGCTGGCTGCTCCGAGG + Exonic
1172136683 20:32690906-32690928 GGCTGGCGGCTGCTGCTCCCAGG + Intergenic
1173737739 20:45373718-45373740 GGGGGAGGGGTGCTGCTCGCTGG + Exonic
1176150479 20:63588314-63588336 GCTGGAAGGTTGCGGGTCCCAGG + Exonic
1176185385 20:63775609-63775631 GGCTGAGGGTTGCAGGTCCCGGG - Intronic
1176427702 21:6558955-6558977 GGAGGAAGGGTGCTGCTCATGGG + Intergenic
1179703194 21:43167272-43167294 GGAGGAAGGGTGCTGCTCATGGG + Intergenic
1180096501 21:45557672-45557694 GGTGGAGGGTTGAGGCTCCCCGG - Intergenic
1181636887 22:24178677-24178699 GGCGGAGAGTTGCTGTCCCCAGG + Intergenic
1185231585 22:49686977-49686999 GGAGGAAGGATGCAGCTCCCTGG - Intergenic
951418783 3:22458737-22458759 GATGGAAGGCTGCTGCTCCGTGG - Intergenic
952241423 3:31533679-31533701 GGCGGCAGGTAGCTCCTCCGCGG + Intronic
952389975 3:32871740-32871762 GGAGGCAAGTTGCTGCTACCTGG + Intronic
952968186 3:38633821-38633843 TTCGGAAGGTTTCTGCACCCTGG - Intronic
953582308 3:44168032-44168054 GGCTAAAGGTTGCTGCTCTAGGG - Intergenic
959310080 3:104724976-104724998 GGCTGTAGTTTGCTGCACCCTGG + Intergenic
960029348 3:113041900-113041922 GGTGGAAGGGAGCTGCTTCCAGG + Intergenic
968521083 4:1035138-1035160 GGAGTCAGGTTTCTGCTCCCAGG - Intergenic
972262565 4:37424702-37424724 GGCGTGAGGCAGCTGCTCCCTGG - Intronic
973953508 4:56040475-56040497 GGGAGAAGGTAGCTCCTCCCTGG + Intergenic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
980701927 4:136442560-136442582 GGAGGAAGGGTGCAGGTCCCTGG + Intergenic
988507587 5:31837369-31837391 GGTGGGAGTTTGCTGTTCCCTGG - Intronic
989570897 5:42945031-42945053 GGCGGCTGGTTGCTGGTGCCAGG + Intergenic
994401745 5:99288975-99288997 GGAGGAAGGTAGCTTGTCCCAGG + Intergenic
995199241 5:109409224-109409246 GGCGGAAAGGTGCTGATCCCGGG + Intronic
997370212 5:133354807-133354829 GGTGGAAAGATGGTGCTCCCGGG - Intronic
998196610 5:140078744-140078766 GGCTGTAGTTTGCTGATCCCAGG - Intergenic
1003052365 6:2791851-2791873 ACCGGAAGGGTGCAGCTCCCTGG - Intergenic
1003139223 6:3456963-3456985 GGGCAAAGGCTGCTGCTCCCGGG + Intronic
1006253792 6:32813334-32813356 GGAGTAAGGTTGCTGCTGTCTGG - Intronic
1006359661 6:33580084-33580106 GGCTGGCGGCTGCTGCTCCCAGG + Exonic
1016940910 6:149482281-149482303 GGGGGAAGGCTGCGGCTCCAGGG - Intronic
1017420537 6:154268079-154268101 GGCGGAAGGGGGCAGGTCCCTGG - Intronic
1020008190 7:4793185-4793207 ACCTGAAGGTTGCTCCTCCCTGG - Intronic
1024025666 7:45408149-45408171 GGCGGAAGGCGGAGGCTCCCGGG - Intergenic
1024046960 7:45591524-45591546 GCCTGCAGGTTTCTGCTCCCTGG + Intronic
1026873082 7:73865115-73865137 GGGGGCAGGCTGCAGCTCCCAGG - Exonic
1029457476 7:100678539-100678561 AGCGGACGGCTGCTGCTCGCTGG + Exonic
1031186796 7:118491907-118491929 TGTGGAAGGTTACTGTTCCCTGG - Intergenic
1034556991 7:151856394-151856416 TGCGGAGGCTTGCAGCTCCCTGG + Intronic
1042722607 8:71842068-71842090 GGAGGAAGGCCGCTGCTCGCAGG - Exonic
1046108251 8:109691688-109691710 GGCGCCAGGATTCTGCTCCCTGG + Exonic
1046654028 8:116874127-116874149 GGCGGAAGGTTGCTGCTCCCGGG + Intronic
1049260492 8:141636364-141636386 GGAGGAAGGACCCTGCTCCCAGG + Intergenic
1050616186 9:7404082-7404104 GGTTGAGGGTTGCTGCTTCCTGG - Intergenic
1053530030 9:38871369-38871391 GTCAGAAGGTTGCTATTCCCTGG + Intergenic
1054202256 9:62095796-62095818 GTCAGAAGGTTGCTATTCCCTGG + Intergenic
1054636102 9:67492564-67492586 GTCAGAAGGTTGCTATTCCCTGG - Intergenic
1055785082 9:79863274-79863296 TCCCGAAGGTTGCTGCACCCAGG + Intergenic
1060046156 9:120342753-120342775 GGTCAAAGGATGCTGCTCCCGGG + Intergenic
1060652376 9:125339564-125339586 GTAGGAGTGTTGCTGCTCCCAGG + Intronic
1060895695 9:127215762-127215784 GGCTGAAGCCTCCTGCTCCCTGG + Intronic
1061208914 9:129179463-129179485 GGGGGCTGGTTGCTGCTCCCAGG + Intergenic
1061707364 9:132463469-132463491 GTCGGAAGCTTGCTGTCCCCTGG + Intronic
1186389809 X:9147886-9147908 GGCGGAAGAAGGCTGCTGCCTGG - Intronic
1189262684 X:39689322-39689344 GGCAGAAGGAGGCGGCTCCCTGG + Intergenic
1198847792 X:140931337-140931359 GGCAGAAGGAAGATGCTCCCTGG - Intergenic
1199729325 X:150615522-150615544 GGCTGAAGTTTGCTGGCCCCTGG + Intronic
1199998933 X:153046565-153046587 GGAGGAAGGGTGCTGTCCCCGGG + Intergenic
1200137778 X:153883343-153883365 GGCAGAAGCCTGCTGCTGCCGGG - Intronic