ID: 1046658656

View in Genome Browser
Species Human (GRCh38)
Location 8:116924768-116924790
Sequence TCCCTGTGTTGAGGGAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046658653_1046658656 9 Left 1046658653 8:116924736-116924758 CCATAAAACAAAGGAAAATTTGT 0: 26
1: 17
2: 18
3: 83
4: 931
Right 1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046658656 Original CRISPR TCCCTGTGTTGAGGGAGTGC TGG Intergenic
No off target data available for this crispr