ID: 1046664544

View in Genome Browser
Species Human (GRCh38)
Location 8:116986366-116986388
Sequence GCCTCTGTAGTCTCCTGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046664538_1046664544 1 Left 1046664538 8:116986342-116986364 CCTCCTCACCCTAGTGCACTAAG 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1046664544 8:116986366-116986388 GCCTCTGTAGTCTCCTGGTTGGG No data
1046664539_1046664544 -2 Left 1046664539 8:116986345-116986367 CCTCACCCTAGTGCACTAAGAGC 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1046664544 8:116986366-116986388 GCCTCTGTAGTCTCCTGGTTGGG No data
1046664541_1046664544 -8 Left 1046664541 8:116986351-116986373 CCTAGTGCACTAAGAGCCTCTGT 0: 1
1: 0
2: 0
3: 4
4: 120
Right 1046664544 8:116986366-116986388 GCCTCTGTAGTCTCCTGGTTGGG No data
1046664540_1046664544 -7 Left 1046664540 8:116986350-116986372 CCCTAGTGCACTAAGAGCCTCTG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1046664544 8:116986366-116986388 GCCTCTGTAGTCTCCTGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046664544 Original CRISPR GCCTCTGTAGTCTCCTGGTT GGG Intronic
No off target data available for this crispr