ID: 1046667295

View in Genome Browser
Species Human (GRCh38)
Location 8:117018438-117018460
Sequence CTTATTCAGCACATCTCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046667294_1046667295 -6 Left 1046667294 8:117018421-117018443 CCATAATGTCTTTGATGCTTATT 0: 1
1: 1
2: 2
3: 27
4: 321
Right 1046667295 8:117018438-117018460 CTTATTCAGCACATCTCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046667295 Original CRISPR CTTATTCAGCACATCTCAAT TGG Intronic
No off target data available for this crispr