ID: 1046668042

View in Genome Browser
Species Human (GRCh38)
Location 8:117026695-117026717
Sequence CCTTATCTGCAGAACAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046668034_1046668042 28 Left 1046668034 8:117026644-117026666 CCTAAATGTACACTGTTAGACAA 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1046668042 8:117026695-117026717 CCTTATCTGCAGAACAGGGGAGG No data
1046668035_1046668042 4 Left 1046668035 8:117026668-117026690 CCACTTTATCTCTCTGATTCCTG 0: 1
1: 0
2: 1
3: 68
4: 653
Right 1046668042 8:117026695-117026717 CCTTATCTGCAGAACAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046668042 Original CRISPR CCTTATCTGCAGAACAGGGG AGG Intronic
No off target data available for this crispr