ID: 1046668444

View in Genome Browser
Species Human (GRCh38)
Location 8:117031822-117031844
Sequence AGCCTACAGAAGCTTAGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 87}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046668444_1046668452 14 Left 1046668444 8:117031822-117031844 CCAATGCTAAGCTTCTGTAGGCT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1046668452 8:117031859-117031881 GACTCTCATTGTTGGGGAGTGGG No data
1046668444_1046668445 -8 Left 1046668444 8:117031822-117031844 CCAATGCTAAGCTTCTGTAGGCT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1046668445 8:117031837-117031859 TGTAGGCTGCTGATACCCGAAGG No data
1046668444_1046668448 7 Left 1046668444 8:117031822-117031844 CCAATGCTAAGCTTCTGTAGGCT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1046668448 8:117031852-117031874 CCCGAAGGACTCTCATTGTTGGG No data
1046668444_1046668450 8 Left 1046668444 8:117031822-117031844 CCAATGCTAAGCTTCTGTAGGCT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1046668450 8:117031853-117031875 CCGAAGGACTCTCATTGTTGGGG No data
1046668444_1046668446 6 Left 1046668444 8:117031822-117031844 CCAATGCTAAGCTTCTGTAGGCT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1046668446 8:117031851-117031873 ACCCGAAGGACTCTCATTGTTGG No data
1046668444_1046668453 27 Left 1046668444 8:117031822-117031844 CCAATGCTAAGCTTCTGTAGGCT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1046668453 8:117031872-117031894 GGGGAGTGGGCTGCTCTTCAAGG No data
1046668444_1046668451 13 Left 1046668444 8:117031822-117031844 CCAATGCTAAGCTTCTGTAGGCT 0: 1
1: 0
2: 1
3: 6
4: 87
Right 1046668451 8:117031858-117031880 GGACTCTCATTGTTGGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046668444 Original CRISPR AGCCTACAGAAGCTTAGCAT TGG (reversed) Intronic
906119827 1:43382027-43382049 AGCCTACTGAAGTTTAGCATTGG - Intergenic
910389937 1:86731090-86731112 AGCCCACAGAAGATTAGAAATGG - Intronic
916330513 1:163610856-163610878 ACCCTAGAGAAGGTTAGCCTGGG - Intergenic
918702580 1:187623731-187623753 AGTCTACAGAAGTTTTGAATAGG - Intergenic
923097578 1:230787817-230787839 AGCCCAAAGAAGCTTGGAATAGG + Intronic
924687083 1:246304829-246304851 AGCCCACAGAGGTTTATCATGGG - Intronic
1063454828 10:6175668-6175690 AGCCAAAAAAAGCTTAGCCTGGG + Intronic
1064036579 10:11918387-11918409 AGCATACAGAAGATTCGCATTGG - Intergenic
1065868160 10:29932164-29932186 ATCCTACAGCAGCCAAGCATGGG - Intergenic
1070010737 10:72471445-72471467 AGCCTAGAGAAACAGAGCATAGG - Intronic
1076247278 10:128957322-128957344 AGCCTACACGGGCTCAGCATTGG + Intergenic
1077162071 11:1118276-1118298 AGCCTGGAGAGGCTGAGCATGGG + Intergenic
1078585048 11:12577914-12577936 GGCCCAGAGAAGCATAGCATGGG - Intergenic
1080543439 11:33292590-33292612 AACCTAAAAAAGCTCAGCATTGG + Intronic
1081905589 11:46667456-46667478 AGCCTAGAGAACCTTAGCCCAGG + Intronic
1086077746 11:82872602-82872624 AGCCAGCAGAAGCTTAGCGAGGG + Intronic
1086079030 11:82883567-82883589 AGCCTACACTAGCTAAGCAAGGG + Intronic
1086467157 11:87066685-87066707 AGACTGCAGAAGTTTATCATAGG - Intronic
1088296852 11:108307492-108307514 ATGCTACAGAAGCTTAGCAGAGG - Intronic
1089818578 11:121200240-121200262 TGCCAGCAGAAGCTTATCATAGG + Intergenic
1091652127 12:2318530-2318552 TGCTTACAGAAGCGTAGCACAGG - Intronic
1095496905 12:42794671-42794693 AGCCATAAGTAGCTTAGCATAGG - Intergenic
1103021809 12:117540303-117540325 AGCCTTCAGCATCTTAGCTTGGG + Intronic
1106152927 13:27123470-27123492 AGCCTACAAATTCTTAGTATTGG - Intronic
1107968220 13:45616039-45616061 AGCCACCACAAGCTTAGCACTGG - Intergenic
1108044729 13:46372780-46372802 AACCTACAGAGGCTTGACATTGG + Intronic
1108501217 13:51071696-51071718 AGCATGCAGAAGCTAAGCAGAGG - Intergenic
1109194761 13:59366408-59366430 ATCCTAGAGAGGCTTAGCAGAGG + Intergenic
1109818290 13:67617296-67617318 AGCCCACAGATGCCTGGCATAGG - Intergenic
1112205658 13:97321098-97321120 AACCCACAGAATCTCAGCATGGG - Intronic
1116704299 14:48277138-48277160 AGCCTTTAGAAGCTTGGCAAAGG - Intergenic
1116757964 14:48971667-48971689 AGCATAAAGAAGCTGAGTATGGG + Intergenic
1122559482 14:102601732-102601754 AGCCTAGAGTAGCCTAGCCTTGG + Intronic
1128977894 15:72166815-72166837 AGCCAACAGAAGCTCTGCCTAGG + Intronic
1129754958 15:78092594-78092616 AGCCTAAAGCAGCTCAGCCTGGG + Exonic
1133111801 16:3552259-3552281 AGCCTGCAGAAGAACAGCATCGG - Exonic
1138238734 16:55408831-55408853 AGCCTGCATAAGCTGATCATGGG - Intronic
1142432318 16:90036346-90036368 AGCAAACAGCAGCTTAGCAGAGG - Intronic
1153383658 18:4467999-4468021 AGCCTACAGAAGCATTGCTTTGG + Intergenic
1154100499 18:11468654-11468676 AGCCCAGAGAACCTTAGCAGGGG - Intergenic
1155493675 18:26422837-26422859 AGCCTACAGAATCCTGGCCTTGG + Intergenic
1158837961 18:61351301-61351323 AGACTACAGGAGCTTACCAGAGG - Intronic
1160050446 18:75428478-75428500 AGCCTACAGAAGCTCATGATGGG + Intergenic
1160187100 18:76684401-76684423 AGCCCACAGACGCGCAGCATGGG - Intergenic
1163966159 19:20749375-20749397 AGCATGCAGAAGCTCATCATGGG - Intronic
1166049891 19:40252380-40252402 AGCCTACAGAATCTTGGTAAAGG + Intronic
926240404 2:11080892-11080914 AGCCTACAGGAACTTGGCAGGGG - Intergenic
928166676 2:28977257-28977279 AGGCTAAAGATGGTTAGCATAGG - Intronic
935902480 2:107807388-107807410 AGCAAACAGAAGCATAGAATGGG + Intergenic
937346375 2:121128348-121128370 ATCCTACAGAAGTTTAGGAGAGG - Intergenic
941769436 2:169329396-169329418 ACTTGACAGAAGCTTAGCATGGG + Intronic
944642368 2:201740905-201740927 AGCCCACAGCAGCACAGCATGGG - Intronic
945979715 2:216299274-216299296 AGGCTGCAGAATCTTAGCTTGGG + Intronic
1170095652 20:12643090-12643112 AGCCTACTGAAGATTAACAAGGG - Intergenic
1177932841 21:27306065-27306087 AGACTGCAGTAGCTTAGCACTGG + Intergenic
1178110780 21:29367976-29367998 AACCTAAAAAAGCTTTGCATTGG - Intronic
1179561109 21:42216788-42216810 AGCCAACAGTAGCGTAGCACAGG - Intronic
1184903164 22:47460205-47460227 AGCCCACAGAATCTTACCCTGGG + Intergenic
1185334722 22:50266417-50266439 AGCCCAAAGTAGCATAGCATGGG + Intronic
949284975 3:2391688-2391710 TGACTACAAAAGCTTTGCATTGG + Intronic
951370858 3:21845992-21846014 AGCCTTCAGAAGTGTAGCGTAGG - Intronic
952496663 3:33921842-33921864 ATCCTCCAGAAGCCTAGCCTGGG - Intergenic
955251537 3:57287745-57287767 ACCCTCCAGAAGCTTTCCATAGG - Intronic
958706977 3:97668367-97668389 AGTCTACAGAATCTTGGCACTGG - Intronic
958733529 3:97984465-97984487 AGCCTGAAGAAGCTGAGTATTGG + Intergenic
962843623 3:139256559-139256581 GGCATACAGAAGTTCAGCATAGG - Intronic
963245591 3:143057315-143057337 AGCCTACAGAAGATTATAAAAGG - Exonic
964683863 3:159372662-159372684 AGCCTACAAAAGCTAAGAATGGG + Intronic
965878421 3:173357115-173357137 AGTCTATAGATGCTTAGAATAGG - Intergenic
967694605 3:192515616-192515638 CTCCTAGAAAAGCTTAGCATAGG + Intronic
970132691 4:12888627-12888649 AGCCCAGAGAAGCTCAGCCTAGG - Intergenic
987237140 5:15954152-15954174 ATCATATAGAAGCTGAGCATAGG + Intergenic
992112069 5:73504426-73504448 AACCTAGAGAATCTTAGCAAGGG + Intronic
993328942 5:86572356-86572378 AGGATACAGAAGCTTACTATGGG - Intergenic
995739327 5:115338402-115338424 AGGCTGCTGAAGGTTAGCATCGG - Intergenic
996324947 5:122262429-122262451 AGCCTACAGAAGCTTTTCCCCGG - Intergenic
1003332819 6:5143978-5144000 AGACCTCAGAAGCTTAGAATTGG - Intronic
1006721658 6:36157613-36157635 AGTATACAGAAGCCTAGCCTGGG + Intergenic
1014038930 6:116801068-116801090 ATCCTACAGAATTTTAGAATGGG + Intronic
1014787952 6:125639440-125639462 AACCTACAGAAGCAAATCATTGG + Intergenic
1015435947 6:133188349-133188371 AGCTGACTGAAGCTGAGCATTGG - Intergenic
1033900804 7:146136607-146136629 ATTCTACAGAAGCTCAGCGTTGG + Intronic
1034010133 7:147520839-147520861 GGTCTACGGAAGCTGAGCATGGG - Intronic
1040464645 8:47683282-47683304 AGCAAACAGCACCTTAGCATGGG + Intronic
1041065615 8:54079901-54079923 AGCTTACAGAAAATCAGCATTGG - Intronic
1043165820 8:76901723-76901745 AGCCCACTGCAGCTCAGCATAGG - Intergenic
1046668444 8:117031822-117031844 AGCCTACAGAAGCTTAGCATTGG - Intronic
1049946002 9:596446-596468 AGCCTAGTTCAGCTTAGCATAGG - Intronic
1050727884 9:8673321-8673343 AGCCAACTCAAGCTTAGGATGGG - Intronic
1056265573 9:84893500-84893522 AGCCTGCAGCAGCTTCTCATTGG + Intronic
1062710645 9:137973377-137973399 AGCCTAGAGCAGCTTTGCAGGGG + Intronic
1186211834 X:7257541-7257563 ATCCTTCAGAAGCTTAGCAAAGG - Exonic
1195139851 X:101948342-101948364 AGCTGACAAAAGATTAGCATTGG + Intergenic
1197529871 X:127610526-127610548 AGCCTTCAGAAGATTATCTTTGG + Intergenic
1199204926 X:145137500-145137522 AGCCACCAGAAGCTAAGAATAGG - Intergenic