ID: 1046668917

View in Genome Browser
Species Human (GRCh38)
Location 8:117036246-117036268
Sequence CAAAATGCTGACAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046668917_1046668920 4 Left 1046668917 8:117036246-117036268 CCCATATCACTGTCAGCATTTTG No data
Right 1046668920 8:117036273-117036295 AAACCATTCAACAAATCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046668917 Original CRISPR CAAAATGCTGACAGTGATAT GGG (reversed) Intronic