ID: 1046670047

View in Genome Browser
Species Human (GRCh38)
Location 8:117047062-117047084
Sequence CACTGTGGATGAGTGGGAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046670038_1046670047 22 Left 1046670038 8:117047017-117047039 CCATGGATTGCCTGCTTTTGGCT 0: 1
1: 0
2: 1
3: 16
4: 226
Right 1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG No data
1046670042_1046670047 -8 Left 1046670042 8:117047047-117047069 CCACCTTGGTTTAGTCACTGTGG 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG No data
1046670040_1046670047 12 Left 1046670040 8:117047027-117047049 CCTGCTTTTGGCTCAGGTGACCA 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1046670047 8:117047062-117047084 CACTGTGGATGAGTGGGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046670047 Original CRISPR CACTGTGGATGAGTGGGAGA CGG Intronic
No off target data available for this crispr