ID: 1046674702

View in Genome Browser
Species Human (GRCh38)
Location 8:117094784-117094806
Sequence TCCAGGCTGTTCATGCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046674692_1046674702 18 Left 1046674692 8:117094743-117094765 CCACCCAGGAGCCTGTCTGCCTC 0: 66
1: 129
2: 164
3: 200
4: 529
Right 1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG No data
1046674694_1046674702 14 Left 1046674694 8:117094747-117094769 CCAGGAGCCTGTCTGCCTCCTGC 0: 106
1: 220
2: 246
3: 291
4: 701
Right 1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG No data
1046674690_1046674702 24 Left 1046674690 8:117094737-117094759 CCCTTTCCACCCAGGAGCCTGTC 0: 36
1: 94
2: 158
3: 275
4: 514
Right 1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG No data
1046674698_1046674702 -4 Left 1046674698 8:117094765-117094787 CCTGCTGTCATTCATGGCGTCCA 0: 1
1: 2
2: 6
3: 37
4: 147
Right 1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG No data
1046674691_1046674702 23 Left 1046674691 8:117094738-117094760 CCTTTCCACCCAGGAGCCTGTCT 0: 48
1: 118
2: 207
3: 322
4: 1341
Right 1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG No data
1046674688_1046674702 29 Left 1046674688 8:117094732-117094754 CCCGTCCCTTTCCACCCAGGAGC 0: 3
1: 28
2: 72
3: 158
4: 506
Right 1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG No data
1046674693_1046674702 15 Left 1046674693 8:117094746-117094768 CCCAGGAGCCTGTCTGCCTCCTG 0: 103
1: 232
2: 274
3: 310
4: 716
Right 1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG No data
1046674695_1046674702 7 Left 1046674695 8:117094754-117094776 CCTGTCTGCCTCCTGCTGTCATT 0: 2
1: 40
2: 106
3: 172
4: 605
Right 1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG No data
1046674689_1046674702 28 Left 1046674689 8:117094733-117094755 CCGTCCCTTTCCACCCAGGAGCC 0: 6
1: 20
2: 71
3: 132
4: 642
Right 1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG No data
1046674697_1046674702 -1 Left 1046674697 8:117094762-117094784 CCTCCTGCTGTCATTCATGGCGT 0: 1
1: 1
2: 15
3: 70
4: 200
Right 1046674702 8:117094784-117094806 TCCAGGCTGTTCATGCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046674702 Original CRISPR TCCAGGCTGTTCATGCCATG GGG Intronic
No off target data available for this crispr