ID: 1046678232

View in Genome Browser
Species Human (GRCh38)
Location 8:117136990-117137012
Sequence AGAAAGGCATTTGTTCTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046678232_1046678235 6 Left 1046678232 8:117136990-117137012 CCAGATAGAACAAATGCCTTTCT 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1046678235 8:117137019-117137041 CAGAATAAATGTGTTTCTTGAGG No data
1046678232_1046678237 14 Left 1046678232 8:117136990-117137012 CCAGATAGAACAAATGCCTTTCT 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG No data
1046678232_1046678236 7 Left 1046678232 8:117136990-117137012 CCAGATAGAACAAATGCCTTTCT 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1046678236 8:117137020-117137042 AGAATAAATGTGTTTCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046678232 Original CRISPR AGAAAGGCATTTGTTCTATC TGG (reversed) Intronic
902915063 1:19633303-19633325 AGAAAGTCACTTGATCTCTCTGG + Intronic
903761981 1:25704815-25704837 AGGAAGGCATGTTTCCTATCTGG + Intronic
906750096 1:48251147-48251169 AGGGAGGAATTAGTTCTATCAGG + Intergenic
908402859 1:63787416-63787438 AGAAAGGCAATAGTTCTACAGGG - Intronic
908918285 1:69158225-69158247 AGAAAGGCAGCTGTTTTACCAGG - Intergenic
909685319 1:78341342-78341364 AGAAAGGCAGTTGTGCTAATTGG + Intronic
910091674 1:83471827-83471849 GGAAAGGCATTTATTGTATGAGG + Intergenic
911282404 1:95946880-95946902 AGAAATGTATTTGTTCTGACTGG + Intergenic
912477716 1:109951215-109951237 AGAAACGCAATTGTTCTATGTGG + Intergenic
912515248 1:110212771-110212793 AGAAAGGCATTCTTTCTGCCAGG + Intronic
912547700 1:110462951-110462973 AATAAGGCATTTGTTATATGTGG + Intergenic
914381750 1:147122580-147122602 AGAAGTGCATTTGTTCAGTCTGG - Intergenic
915873777 1:159590196-159590218 TGAAAGGCATTTGGGCTATGGGG + Intergenic
916349735 1:163835459-163835481 AGGAAGGTATTTGTTTAATCTGG + Intergenic
917329911 1:173870068-173870090 AGGAAGGTATTTCTTTTATCTGG + Intronic
917785410 1:178450929-178450951 AGGTAGGAATTTGTTCTTTCAGG + Intronic
919279744 1:195473967-195473989 AAAAAGGCATTTCTTCTAAGTGG + Intergenic
921353144 1:214258041-214258063 AGAAAGGCATTTCTTCTCCTTGG + Intergenic
923363994 1:233241351-233241373 AGAAAGACTTTTGTTCTCTGGGG - Intronic
923470002 1:234282062-234282084 AGAGAGGCCTTTGTTCCATCTGG - Intronic
923475446 1:234327140-234327162 AGAAACACATCTGTTCTATGGGG - Intergenic
924506233 1:244687456-244687478 ACAAAGGCATTTCTGCTATAGGG - Intronic
924697367 1:246414431-246414453 AGACAGGCTTTGGTTCTATGTGG - Intronic
1062927798 10:1329912-1329934 AAAAAGGCACTTCTTCTACCTGG - Intronic
1065306500 10:24373992-24374014 AGAATGGCATTTGTTCTGGATGG - Intronic
1065828460 10:29593555-29593577 TGGAAGGCATTTGATGTATCTGG - Intronic
1066275192 10:33861914-33861936 TGAAAGTCATTAGTGCTATCTGG + Intergenic
1070489289 10:76960986-76961008 AGAATGGTAGTTGTTCTAGCAGG - Intronic
1070587129 10:77774908-77774930 AGACAGGCATCTGTTCTGTTAGG - Intergenic
1071885038 10:89940486-89940508 AGAAAAGCATTTCTTCTGTTTGG - Intergenic
1072859859 10:98991994-98992016 GGAAAGGCATTGGTGCTATATGG - Intronic
1072898430 10:99387355-99387377 AGAAATGCCTGTGTTCTCTCAGG + Intronic
1074140412 10:110667396-110667418 AGGATGGCATTTTTTCTACCTGG + Intronic
1074200658 10:111232059-111232081 AGAAATAGATTTGTTCTATCAGG - Intergenic
1078817738 11:14843982-14844004 AGAAATGCATTTGTCCTCCCTGG - Exonic
1078862461 11:15262353-15262375 ATAAAGGCATTTGATAAATCAGG + Intergenic
1080342420 11:31281400-31281422 AGAAGGGAATTTCTTCAATCTGG - Intronic
1081333269 11:41830986-41831008 GCAAGGGCATTTGTTCTATCAGG - Intergenic
1084450767 11:69235260-69235282 AGAAAGGCAATGGGTCTCTCAGG - Intergenic
1085020012 11:73200652-73200674 AGGAAGGCATTTTTCCTAGCAGG + Intergenic
1088107934 11:106226866-106226888 AGAAAGGCCTTTTTGGTATCTGG - Intergenic
1088207183 11:107405906-107405928 AGAAAGGCAATTATACTATTTGG + Intronic
1090149794 11:124371690-124371712 GGAAAGTAATTTTTTCTATCAGG + Intergenic
1093043628 12:14415233-14415255 AAAATGGCATTTGTTGGATCAGG + Intronic
1093058569 12:14579549-14579571 AAAAAAGGATTTGTTCAATCAGG - Intergenic
1093200830 12:16184451-16184473 AGAAAGGCAGTGGTTCTACCAGG - Intergenic
1094688128 12:32740735-32740757 AGAGATTCTTTTGTTCTATCTGG + Intronic
1095311334 12:40700637-40700659 AAAAATGCATTTGACCTATCTGG - Intronic
1095451152 12:42331543-42331565 AGAAAGGCTTCTTTTCTTTCTGG + Intronic
1095489372 12:42717168-42717190 AGAAAGGAAGTTCTTCCATCTGG + Intergenic
1095540556 12:43304400-43304422 AGACAGGCATTAGTTCCCTCAGG + Intergenic
1096455471 12:51781282-51781304 AGAAAAGCATTTCTTCTCCCAGG - Intronic
1097238188 12:57554038-57554060 TGAAAGGCTTTAGTTCTGTCTGG + Intronic
1098434384 12:70453161-70453183 AGAAAGACATTTAGTCAATCTGG - Intergenic
1100448992 12:94687422-94687444 AGAAAGGCATTTGCTTTATCTGG + Intergenic
1101522008 12:105492727-105492749 TAAAAGGCATTTCTTCTGTCTGG - Intergenic
1102612412 12:114124093-114124115 ACAAAGGCCACTGTTCTATCTGG + Intergenic
1102827425 12:115961241-115961263 GGAAAAGCACTTGTTCTCTCTGG - Exonic
1104929998 12:132333691-132333713 AGAAAGGCATTTTCTCACTCAGG + Intergenic
1106460451 13:29963598-29963620 CTAAAGGCATTATTTCTATCAGG - Intergenic
1107456145 13:40556606-40556628 GGAAAGGCATCTGGTCTGTCTGG - Exonic
1108035075 13:46282314-46282336 AGAAAGGTATTTGTGATATAAGG - Intergenic
1109234565 13:59799116-59799138 AGAAATCCAATTGTTCTATTTGG + Intronic
1109246537 13:59960911-59960933 AGACAGGGATTTGTTGAATCAGG - Intronic
1110015385 13:70393902-70393924 ACAGAGGCATTTTTTCGATCTGG - Intergenic
1110357489 13:74584658-74584680 GGAAAGCCACTTGTCCTATCAGG + Intergenic
1110420954 13:75307790-75307812 AGAAAGCCATCTGTGGTATCCGG - Intronic
1111314929 13:86542764-86542786 AGAAAGAAATTTGTTCTAATTGG - Intergenic
1111401546 13:87743035-87743057 AGGAAGGCATGTGTACTAGCGGG - Intergenic
1112111189 13:96300957-96300979 AGAGAGGCATTTGCCTTATCTGG + Intronic
1112840718 13:103573849-103573871 GGAAAGCCATATGTTCTCTCTGG - Intergenic
1113560925 13:111280329-111280351 AGAAATGCATTTGAAATATCAGG + Exonic
1115440360 14:33427431-33427453 AGAAAGGCATTACTTTTATACGG + Intronic
1118310959 14:64692738-64692760 AGAAAGGGACCTGCTCTATCAGG - Intergenic
1120465560 14:84852942-84852964 AGAAAGGCATATTCTTTATCTGG - Intergenic
1123807849 15:23893677-23893699 AGATGGGCATTTGTTTTACCAGG + Intergenic
1124440684 15:29683971-29683993 AGAAAGGCTTTTCTTGTTTCAGG + Intergenic
1124863944 15:33470960-33470982 AGAAAGGCTTGTGTTCTAATTGG + Intronic
1125189842 15:36977994-36978016 AGAAAGGCACATGTTCTACAAGG + Intronic
1128493214 15:68171709-68171731 AGAAAGGCATTTAGCCTTTCTGG - Intronic
1134382941 16:13745230-13745252 AGAAAGGAATTTGTTTTATTTGG - Intergenic
1140904510 16:79398911-79398933 AGCAAGGCATGTGTTCTTCCAGG - Intergenic
1141386163 16:83624262-83624284 AGAAAGACTTTTGGTCTCTCTGG + Intronic
1146403817 17:32520361-32520383 AGCAAGGCATTCGTGCTAACAGG - Intronic
1147720266 17:42535696-42535718 ATAAATGCATTTCTTCTGTCTGG + Intergenic
1148166536 17:45487968-45487990 AGAAAGGCAGCTGATCTTTCAGG + Intronic
1148367891 17:47070390-47070412 AGAAAGGCAGCTGATCTTTCAGG - Intergenic
1148374393 17:47129143-47129165 AGAAAGGCAGTTTTTTCATCAGG - Intronic
1149403072 17:56318634-56318656 AGAAAGACATTCATTCCATCGGG + Intronic
1149527786 17:57370360-57370382 AGAATGGCATTTCTTCTATTTGG - Intronic
1149579014 17:57734985-57735007 AGGAAGACATTTTTTCTTTCTGG - Intergenic
1150397707 17:64834369-64834391 AGAAAGGCAGCTGATCTTTCAGG + Intergenic
1155871341 18:31032410-31032432 AGAAAGGAATTTGCTCAATATGG + Intronic
1156338578 18:36190189-36190211 AGAAAGGCTTTTGTTCACCCAGG - Intronic
1157712028 18:49856794-49856816 AGAAAGGAATATGTTCCACCTGG + Exonic
1158527085 18:58224579-58224601 TGAAAGGAATTTGTTCTCTTTGG + Intronic
1159781223 18:72662955-72662977 GGACAGACTTTTGTTCTATCTGG + Intergenic
1159827126 18:73227125-73227147 AGAAAGGCAATTGTTTGATCTGG - Intronic
1160287864 18:77562409-77562431 TAGAATGCATTTGTTCTATCAGG + Intergenic
1165351421 19:35277899-35277921 AGAAAGGCATGTGCTCTGTCTGG + Intronic
1166035597 19:40165923-40165945 AGAAAGGCATTTATTAGGTCTGG + Intergenic
1166752648 19:45172042-45172064 AGGAAGGCCTTTGTTCTCTAAGG - Intronic
1166752915 19:45173234-45173256 AGGAAGGCCTTTGTTCTCTAAGG - Intronic
926447198 2:12957431-12957453 AGTAAGGCTTTTGTTCTGTAGGG + Intergenic
926871520 2:17423418-17423440 TGCAAGCCATTTTTTCTATCAGG - Intergenic
927372874 2:22377751-22377773 AGAAAGGCATGTGTTTTGTTTGG + Intergenic
927391691 2:22603252-22603274 AGAAAGTCATTTATTCTCTTTGG + Intergenic
927986137 2:27411844-27411866 ATAAAGGCTTATATTCTATCAGG - Intergenic
930203851 2:48568984-48569006 AGCAAGGCATTGGATCTCTCTGG + Intronic
932652561 2:73574694-73574716 AGTAAGGCTTTTGTTCCATAGGG + Intronic
934091018 2:88550247-88550269 AGAAACGCCTTTGTTGTATAGGG - Intergenic
935670511 2:105552886-105552908 AAAAAGTCATTTGTTCTATGCGG - Intergenic
936160979 2:110084156-110084178 AGAAAGGGACTTGTCCTAACTGG - Exonic
936183684 2:110287198-110287220 AGAAAGGGACTTGTCCTAACTGG + Intergenic
937013512 2:118582728-118582750 AGACAGGAATTTGTTCTGTATGG + Intergenic
937090421 2:119202549-119202571 AGAAAGGGATTAGTTCTTGCTGG - Intergenic
937946119 2:127339330-127339352 AGAAAAGAATTTGTTATAACAGG - Intronic
939529831 2:143344266-143344288 ATAAATGCATTAGTTATATCAGG - Intronic
942783520 2:179673578-179673600 AAAAAGGCAATTTTTCTCTCAGG + Intronic
944286018 2:197950501-197950523 AGAAAGGAATATGGTATATCAGG + Intronic
944629627 2:201610987-201611009 AGCCAGGCATTTGTTATATATGG - Intronic
945285740 2:208079409-208079431 AGAAGTACATTGGTTCTATCTGG - Intergenic
1169326198 20:4678887-4678909 AGAAAGGGACTTGTTCTTCCTGG - Intergenic
1171469127 20:25356012-25356034 AGAATGGCTTTTGTTCTCTCAGG - Intronic
1174765862 20:53253668-53253690 AGGAAGTCATTTGTCCAATCAGG + Exonic
1175265607 20:57701676-57701698 AGAATGACATCTGTTCTATGGGG - Intronic
1175412526 20:58780078-58780100 AGGGAGGCATTTGTTGAATCAGG + Intergenic
1175833348 20:61978936-61978958 AGAAAGGCAATTGGAGTATCAGG - Intronic
1177327787 21:19614795-19614817 AGAAATGCATTTGTTGTCCCTGG + Intergenic
1178515514 21:33243629-33243651 AGAGAGGCAATAGTTTTATCTGG - Intronic
1179344130 21:40540328-40540350 AGAGAGGAATTGGTTCTATCTGG - Intronic
1179373690 21:40829969-40829991 AGAAAGCCATGTTTGCTATCTGG + Intronic
1180258404 21:46649915-46649937 ATAAAGGCATTTTTTAAATCAGG - Intronic
1181933859 22:26426114-26426136 AGCAAGGCATGTTTTCTCTCTGG + Intergenic
950147879 3:10664726-10664748 AGCAAGGTATTTGATCTAGCGGG + Intronic
951649616 3:24936440-24936462 AGAAAGGCATTTTTCATATTAGG + Intergenic
952745326 3:36771510-36771532 AGCAAGGAATTTGTACTAGCTGG - Intergenic
953509773 3:43524229-43524251 AGAAAGTCATTCCTTCTATGAGG - Intronic
957458537 3:80486651-80486673 AGAAAGACCTGTGTTCTCTCAGG + Intergenic
958564692 3:95794945-95794967 AGAATGTCCTTTGTTCTATCAGG + Intergenic
959690095 3:109189300-109189322 AGAAAGCCCTTTCTTCTCTCAGG + Intergenic
962463855 3:135639011-135639033 AGAAAGGCCTTTGTACTTTGGGG + Intergenic
963194999 3:142517254-142517276 TGAACTGCAGTTGTTCTATCTGG + Intronic
963864283 3:150343548-150343570 AGAAAGACATTTGACCTATTGGG - Intergenic
964789374 3:160437584-160437606 ATAAAGGTATATGTTCTTTCAGG + Exonic
965671038 3:171148059-171148081 AGAAAGGAATGAGTTATATCTGG - Intronic
966531536 3:180987022-180987044 ACAAATGCATTTCTTCTTTCAGG - Exonic
966708224 3:182941260-182941282 AAAAGGGCATTTGTACTATTAGG + Exonic
972872939 4:43323262-43323284 ATAGAAACATTTGTTCTATCTGG + Intergenic
972953522 4:44359323-44359345 AGAAAAGCATTTGATGTTTCAGG - Intronic
973668134 4:53183994-53184016 TGAAAGGCATTTGTTGTATTAGG - Intronic
974594127 4:63995199-63995221 GGAATGGCATTTCTTCTATGTGG + Intergenic
977306242 4:95327198-95327220 ATAAAGGCATTTGTTTTTTTAGG - Intronic
980379905 4:132000295-132000317 ATAAGGGAATTTGTTCCATCAGG + Intergenic
980834030 4:138167986-138168008 AGAAAGTCACTTGTTATATATGG + Exonic
982532625 4:156565308-156565330 AGAAAAACATTTGTTTTAGCAGG - Intergenic
982639215 4:157936201-157936223 AGAAAGTCATTTCATCTACCTGG + Intergenic
983674162 4:170272523-170272545 AAAAAGGCATTTTTATTATCAGG + Intergenic
984547446 4:181123795-181123817 AAAAAGGCATTTAGTCCATCAGG - Intergenic
986947624 5:13043893-13043915 AGAAGTCCATTGGTTCTATCTGG - Intergenic
986999824 5:13648849-13648871 AGAGGGGCATTCGTTCTGTCAGG - Intergenic
989082156 5:37634548-37634570 AGAAATGACTTTGTTCTATAAGG + Intronic
989124516 5:38038702-38038724 ACAAAGACATTTCTTCCATCTGG - Intergenic
989807163 5:45623550-45623572 AAAAAGGCAGTTCTTCTTTCAGG + Intronic
990931464 5:61096126-61096148 TGAAAAATATTTGTTCTATCAGG - Intronic
991206611 5:64057310-64057332 AAAAAGCCATTTGTTCTACCTGG + Intergenic
991403163 5:66275187-66275209 AGCAAGGCACTTGCCCTATCTGG - Intergenic
991472827 5:66987072-66987094 AGAAAAACATTTATTCTTTCAGG - Intronic
991615619 5:68494141-68494163 AGAAATGCATTAGTTTGATCTGG - Intergenic
992108006 5:73466267-73466289 AGATATGCATTGGTTTTATCTGG + Intergenic
992635392 5:78721447-78721469 AGAAAGGTATTTTTTCTATATGG - Intronic
993359382 5:86955161-86955183 AGAAAGCCACTTGTTCTACCAGG - Intergenic
994740600 5:103613074-103613096 AGAAAGGCATTTAATCTTTAAGG - Intergenic
995290609 5:110447243-110447265 AGAAATTCATTTGTTCTAAGAGG - Intronic
995539981 5:113176117-113176139 AGCAAGGCATTTGTTATAATGGG + Intronic
995741424 5:115359605-115359627 AGATTGACATTTGTTCTACCGGG - Intergenic
999021193 5:148167156-148167178 GGAAAGTAATTTATTCTATCTGG - Intergenic
999511510 5:152257294-152257316 AAAAAGTCATTTTTTCTTTCTGG - Intergenic
999649052 5:153747664-153747686 AGAAAGGCATTTCTTGGAGCAGG - Intronic
1000206316 5:159063067-159063089 AGAAATGCAGTTGTTGAATCTGG - Intronic
1000460204 5:161506882-161506904 AGAAAATCATTTTTTCTATTTGG - Intronic
1001249218 5:170133356-170133378 AGAAAGGAATTTTCTCTGTCAGG + Intergenic
1004794403 6:19064962-19064984 AGAAAGGCTTTTGTTGTAAAAGG + Intergenic
1004808672 6:19234144-19234166 ATTAAGGCTTTTGTTCTATAGGG - Intergenic
1005266959 6:24122246-24122268 AGACAGACATCTGTTCCATCCGG + Intergenic
1008942901 6:57066461-57066483 AGAAGGGCATTTGTTTTGTTGGG + Intergenic
1011014549 6:82740548-82740570 GCAAAGGCTTTTGTTCTTTCTGG + Intergenic
1011019844 6:82800446-82800468 AGCCAGGCATTTATTCTCTCTGG - Intergenic
1012196425 6:96347196-96347218 GGAAAGGCATTTTGTCTATTTGG - Intergenic
1012385854 6:98681549-98681571 AGAATGGCATAGGTTGTATCAGG - Intergenic
1012646567 6:101691103-101691125 ACAAATGCATTTATTCAATCAGG - Intronic
1014824133 6:126028872-126028894 ATAAAGACATGTGTTCTCTCAGG - Intronic
1014870728 6:126593566-126593588 AGAAAGCCATGTGGCCTATCGGG - Intergenic
1015754775 6:136596337-136596359 AGAAAGGCACTTGTTGGATTTGG + Intronic
1015877308 6:137835547-137835569 AGAAAGGAAATAGTTTTATCAGG + Intergenic
1015952754 6:138570427-138570449 GAAAAGGCATTTGTGCTTTCTGG - Intronic
1017364330 6:153616167-153616189 TGAAAGGCTTTTGTTGTGTCGGG + Intergenic
1020464445 7:8461255-8461277 AGAAAGGGATTTGTGCCAACTGG - Intronic
1021202970 7:17746183-17746205 GGAAAGACATTTATTCTTTCTGG + Intergenic
1021477940 7:21084099-21084121 TGAAAGGCATTTGGTCTACGAGG - Intergenic
1022050620 7:26665430-26665452 ATAAAGGCATTTTCTCTACCAGG + Intergenic
1026589718 7:71684307-71684329 AGAAAGGCAAAGGTGCTATCAGG + Intronic
1027308525 7:76928279-76928301 GGAAAGGCATTTATTGTATGAGG + Intergenic
1028597366 7:92559742-92559764 ATAAAGCCAATTTTTCTATCTGG + Intergenic
1030451041 7:109711862-109711884 TGAAAGGAATTTGATCTATTAGG - Intergenic
1031364085 7:120883071-120883093 GGAAAAGCATTTTTTATATCTGG - Intergenic
1032536852 7:132671598-132671620 AGGAAGGCATTTCGTCTCTCTGG + Intronic
1034528915 7:151683424-151683446 AGATAGGCATCTGGTCTACCTGG - Intronic
1036754820 8:11465135-11465157 GGAAAGCCATTTCTTCTATTAGG - Intronic
1038062787 8:23930914-23930936 AGAAAGGCATTTCCTCTCTCTGG - Intergenic
1039323662 8:36461361-36461383 AGAATGACACTTGTTCTATAAGG - Intergenic
1040417612 8:47209040-47209062 AGATGTGCATTGGTTCTATCTGG - Intergenic
1041682827 8:60610277-60610299 AGTAAGTCATGTGTTCTCTCTGG - Intronic
1041949225 8:63481802-63481824 AGAAAGCCATTTGTTAAAACAGG - Intergenic
1043002416 8:74775219-74775241 ATAAAGGCATTTATTCTTTCTGG - Intronic
1043250571 8:78068033-78068055 AGAAAAGCATTTGTTATAGGAGG - Intergenic
1044031454 8:87242605-87242627 AGATGTGCATTGGTTCTATCTGG - Intronic
1046678232 8:117136990-117137012 AGAAAGGCATTTGTTCTATCTGG - Intronic
1046751005 8:117926457-117926479 AAAAAGCCATTTTTTCTTTCAGG + Intronic
1046807668 8:118498079-118498101 GGCAAGGCATGTGTTATATCAGG + Intronic
1048674712 8:136765793-136765815 AGAAATGCATGTGTTATTTCCGG + Intergenic
1049369793 8:142258816-142258838 AGAAAGGCATGCGTTCTGGCTGG - Intronic
1049380146 8:142308687-142308709 CGAAAGGGATTTATACTATCAGG - Intronic
1049523810 8:143110242-143110264 AGACATACATTTGTTCGATCAGG - Intergenic
1050489142 9:6168752-6168774 AGAAATGCAGTGGTTCTATATGG - Intergenic
1051916964 9:22220124-22220146 AGAAAGACAGTTATTCTGTCTGG + Intergenic
1051938026 9:22467950-22467972 ATACAGGCCTTTATTCTATCTGG - Intergenic
1052634505 9:31084468-31084490 ACACAGGCATTTGTTCAATCTGG - Intergenic
1053185915 9:36016290-36016312 AAAAATCCATTTGTCCTATCAGG + Intergenic
1053330402 9:37200857-37200879 AGAAATGCATGTGTTTTAACTGG + Intronic
1055515638 9:77030526-77030548 AGATATGTTTTTGTTCTATCTGG - Intergenic
1056160471 9:83886217-83886239 AGAAAGTCATTGATTCTATTGGG - Intronic
1057319451 9:93999054-93999076 AGAAAATAATTTGTTCTCTCTGG - Intergenic
1058361266 9:104149483-104149505 AGAAATGCAGTTGTTTTATTTGG + Intergenic
1058361326 9:104150040-104150062 AGAAATGCAGTTGTTTTATTTGG + Intergenic
1058600004 9:106659178-106659200 AGAAATGGAATTGTCCTATCTGG - Intergenic
1060355442 9:122903626-122903648 AAACAGGCACTTGTTCTATGAGG - Intronic
1187831793 X:23389564-23389586 AGAAAGGAATCTGACCTATCAGG + Intronic
1190186435 X:48238607-48238629 AGAAAGGATTTTTTTATATCAGG - Intronic
1192828198 X:74721084-74721106 AGAAAGGCATTTGCAAAATCCGG + Intergenic
1192926056 X:75756581-75756603 ATAAAGGCATTTTCTCTACCAGG - Intergenic
1193419111 X:81262356-81262378 AGAAAGGCATTTCTTCTTTGTGG + Intronic
1193570866 X:83141179-83141201 AGAAAGGCAAATTTTCTTTCTGG + Intergenic
1194773737 X:97937198-97937220 AGTAAGACATTTTTTCTATTAGG + Intergenic
1195437281 X:104859674-104859696 AGAAAGTAATTTTTTCTAACTGG + Intronic
1195486815 X:105418006-105418028 AGAGAGGGATTTGTTCTACATGG - Intronic
1196338271 X:114565031-114565053 AGAAAGGGATTTATTTGATCAGG + Intergenic
1199163338 X:144640786-144640808 AGAAAGGCATTTCTTTTGTAGGG - Intergenic
1201693741 Y:16799738-16799760 AGAAGAACATTGGTTCTATCTGG - Intergenic