ID: 1046678234

View in Genome Browser
Species Human (GRCh38)
Location 8:117137006-117137028
Sequence ATTTATTCTGACCTCAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 212}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046678234_1046678237 -2 Left 1046678234 8:117137006-117137028 CCTTTCTTGAGGTCAGAATAAAT 0: 1
1: 0
2: 0
3: 16
4: 212
Right 1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG No data
1046678234_1046678239 18 Left 1046678234 8:117137006-117137028 CCTTTCTTGAGGTCAGAATAAAT 0: 1
1: 0
2: 0
3: 16
4: 212
Right 1046678239 8:117137047-117137069 TGGCTAATTACAACAGAACTGGG No data
1046678234_1046678236 -9 Left 1046678234 8:117137006-117137028 CCTTTCTTGAGGTCAGAATAAAT 0: 1
1: 0
2: 0
3: 16
4: 212
Right 1046678236 8:117137020-117137042 AGAATAAATGTGTTTCTTGAGGG No data
1046678234_1046678240 24 Left 1046678234 8:117137006-117137028 CCTTTCTTGAGGTCAGAATAAAT 0: 1
1: 0
2: 0
3: 16
4: 212
Right 1046678240 8:117137053-117137075 ATTACAACAGAACTGGGCTGTGG No data
1046678234_1046678235 -10 Left 1046678234 8:117137006-117137028 CCTTTCTTGAGGTCAGAATAAAT 0: 1
1: 0
2: 0
3: 16
4: 212
Right 1046678235 8:117137019-117137041 CAGAATAAATGTGTTTCTTGAGG No data
1046678234_1046678238 17 Left 1046678234 8:117137006-117137028 CCTTTCTTGAGGTCAGAATAAAT 0: 1
1: 0
2: 0
3: 16
4: 212
Right 1046678238 8:117137046-117137068 ATGGCTAATTACAACAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046678234 Original CRISPR ATTTATTCTGACCTCAAGAA AGG (reversed) Intronic
901327608 1:8377893-8377915 ATCTTTTCTGAGCTCAAAAATGG - Intronic
901908270 1:12433327-12433349 ATTTCATCTGGCCTGAAGAAGGG - Intronic
902066666 1:13693933-13693955 ATTCATTCTGCCTTCAAGGAAGG + Intergenic
902729966 1:18362825-18362847 ATTTTTTATGACCTCTTGAAGGG + Intronic
909722099 1:78785354-78785376 ATTTATATAGACATCAAGAATGG + Intergenic
915799821 1:158778622-158778644 AACTATTCTGACCTCAAGCTCGG + Intergenic
916785893 1:168086824-168086846 ATTCATTCTGAACTCAGGGAGGG + Intronic
917889605 1:179422476-179422498 ATTTTTTCTGACCACAATGATGG - Intronic
919022381 1:192123717-192123739 ATGTATACTGACTTCAAAAAAGG - Intergenic
919580873 1:199370692-199370714 ACTCATTCTGACCGCAACAAAGG - Intergenic
921386388 1:214574302-214574324 AGGTATTATGAACTCAAGAAAGG - Intergenic
922314551 1:224431979-224432001 ATTGATTCTGGTTTCAAGAAAGG - Intronic
923914762 1:238489668-238489690 ATTTTTCCTGAGCTGAAGAAAGG - Intergenic
924126725 1:240862433-240862455 TATTATTCCAACCTCAAGAATGG - Intronic
924413023 1:243826251-243826273 TTTCAATCTGACCTCTAGAAAGG + Intronic
1068993537 10:63176871-63176893 ATTTATACTTACCTCAAAAAAGG - Intronic
1070183629 10:74038740-74038762 ATATATTCTGACCTCAGTAGAGG - Intronic
1070508938 10:77141810-77141832 ATTTTTTCAGACCTCTAGCAAGG + Intronic
1072877023 10:99183442-99183464 ATTTGTTTTATCCTCAAGAAAGG + Intronic
1073084921 10:100882197-100882219 ATTTATTCTGATCAATAGAATGG - Intergenic
1073864719 10:107788376-107788398 ATTCATTCTTAGCTAAAGAATGG - Intergenic
1076348771 10:129800257-129800279 CTTTTTTGTAACCTCAAGAAAGG + Intergenic
1079985549 11:27196947-27196969 ATTTATTTAGTCCTCAAGATTGG - Intergenic
1080322967 11:31036259-31036281 ATTTATTCTGAACTTGAGAAAGG + Intronic
1080955265 11:37086360-37086382 ATTTATTTTGATATAAAGAATGG - Intergenic
1081836309 11:46158077-46158099 AGTTACCCTGTCCTCAAGAAGGG - Intergenic
1082897155 11:58204143-58204165 ATTTCTGCTGATCTGAAGAAAGG + Exonic
1085555980 11:77422108-77422130 ATTTATTTTTACCTCTAGACTGG + Intronic
1086455018 11:86952609-86952631 GTTTACTCTGACCTCAAACAAGG + Intronic
1087666803 11:101058834-101058856 ATTTATTTTGAACTGAATAATGG - Intronic
1088191214 11:107230384-107230406 ATCTCTTCTGACCCAAAGAACGG + Intergenic
1090570937 11:128044692-128044714 ATTTATTATTTTCTCAAGAAAGG - Intergenic
1093143684 12:15538968-15538990 TTTTATTCTGAACTCAGGTATGG - Intronic
1093229320 12:16524409-16524431 GTTCATTCAGATCTCAAGAAAGG - Intronic
1093848117 12:23999452-23999474 AAGTATTCTTACCACAAGAAGGG + Intergenic
1097496098 12:60337070-60337092 ATATATTCAGTCCTAAAGAAAGG - Intergenic
1098029754 12:66241624-66241646 ATTTATTCTGTTCTAAATAAAGG - Intronic
1100191283 12:92194848-92194870 ATTTGTTTTGAGCTCGAGAATGG + Intergenic
1103338818 12:120210315-120210337 AGGGATTTTGACCTCAAGAAAGG + Intergenic
1104392272 12:128400920-128400942 ATTTTTTCTGTTGTCAAGAATGG - Intronic
1108730746 13:53232941-53232963 ATTTCTTCTTATCTCAATAATGG + Intergenic
1109564215 13:64089948-64089970 ATTTACTATGTCCTCAAGAAGGG + Intergenic
1109793537 13:67279981-67280003 CTTTATAATGACCTCAAAAAGGG - Intergenic
1111072315 13:83184674-83184696 ATTTATTATAACAACAAGAAAGG - Intergenic
1113697482 13:112356208-112356230 ATTAATTTTGACCTTAAAAAAGG - Intergenic
1115994849 14:39185677-39185699 ATTCATTTTAACCTCAAAAAGGG - Intergenic
1116344013 14:43766146-43766168 AAGTATTCTTACCTCAAAAATGG - Intergenic
1117473498 14:56070488-56070510 ATATATTTTGGCCTCTAGAAAGG - Intergenic
1119776813 14:77254090-77254112 ATTGAATCTGACCCCAGGAATGG + Intronic
1122750001 14:103926322-103926344 ATTCATTGTGACATCAACAAAGG + Intronic
1125995944 15:44161122-44161144 ATTTATTGTTAACTCAAGGAGGG - Intronic
1126801708 15:52303984-52304006 ATTTAATGTCAACTCAAGAATGG + Intergenic
1126992376 15:54394551-54394573 AACTACTCTGTCCTCAAGAAAGG - Intronic
1135718925 16:24797956-24797978 ATTTTCTCTTACCTCCAGAAAGG - Exonic
1137361928 16:47826282-47826304 ATTGATTCTGACCTCTAAGAGGG + Intergenic
1138640859 16:58385594-58385616 ATTTATTTTGATCTCATGGAAGG + Intronic
1139238284 16:65363126-65363148 ATTTATTCTGAATTTATGAATGG + Intergenic
1140572159 16:76120107-76120129 ATTTTTTCTGAACTCTAAAAAGG - Intergenic
1141286179 16:82674302-82674324 CTCTAGTCTGACCTGAAGAAAGG - Intronic
1141571402 16:84936041-84936063 ATTGGTTGTGACATCAAGAAAGG + Intergenic
1143945396 17:10587274-10587296 AGGTATTCTGCCCTCAAGGAGGG - Intergenic
1145284238 17:21492884-21492906 ATATATTGGGACCTCAAGAAGGG + Intergenic
1147799811 17:43076245-43076267 TTTTTTTCTGACCTTCAGAAGGG + Intronic
1149533900 17:57417220-57417242 ATTTATTCTGGGCTCCATAAAGG + Intronic
1150872840 17:68932503-68932525 ATTTGTTGTGATCTGAAGAAAGG + Exonic
1156593608 18:38520233-38520255 ATATATTCTCCCCTCAGGAAAGG + Intergenic
1157929458 18:51805273-51805295 TTTTATTCTTTCATCAAGAATGG - Intergenic
1158129505 18:54137266-54137288 AATTAGTCTGTCATCAAGAAAGG + Intergenic
1159172406 18:64788502-64788524 ATATATTCTTCCCTCAAGGAGGG - Intergenic
1159819041 18:73116375-73116397 AGGTATTCTGTCCTCAAGGAGGG + Intergenic
1162593393 19:11607957-11607979 ATTTATTCACAGCGCAAGAATGG - Intronic
1165711468 19:38014078-38014100 GTTTACTCTGACCACAAGTAAGG - Intronic
1165971128 19:39631017-39631039 GTTTATTCTGATTTCAACAACGG + Intergenic
1166393287 19:42422220-42422242 ATTCATTCTAACCTCACAAAAGG + Intronic
1166404046 19:42506569-42506591 CTTTATTCTGCCCTCTAGGAGGG - Intergenic
1167978117 19:53248983-53249005 ATTTAATCTGAGCAGAAGAAAGG - Intronic
1168673266 19:58257659-58257681 ATTCATGCTGACTTCATGAACGG - Intronic
927523873 2:23720157-23720179 ATTCATTCTTCCCACAAGAAAGG + Intergenic
928150410 2:28823286-28823308 ATGTATTCTGACCTATAGATTGG - Intronic
929209126 2:39334629-39334651 AGTTAGTCTGAGCTGAAGAAAGG - Intronic
930280727 2:49366703-49366725 ATTTTTTCTAACCATAAGAATGG + Intergenic
931769825 2:65487864-65487886 AGTTGTTCTGACCTGAGGAAAGG + Intergenic
933171357 2:79129434-79129456 ATTTACTCTGACCTAAGTAATGG + Intergenic
933224429 2:79729199-79729221 AATTATTCTGACCTCATGTCCGG + Intronic
933945958 2:87286389-87286411 ATTGATTCTGACTCCAAGGATGG + Intergenic
934712710 2:96526456-96526478 GTTCATTCTGACCTCAGGACAGG - Intergenic
934861993 2:97771841-97771863 GTTTATTCTTACCTTAAAAATGG - Intronic
935188043 2:100751904-100751926 CTTCCTTCTGAGCTCAAGAAAGG + Intergenic
935681717 2:105644092-105644114 ATTTCTGCAGACCCCAAGAAAGG + Intergenic
936334254 2:111575197-111575219 ATTGATTCTGACTCCAAGGATGG - Intergenic
936816894 2:116471098-116471120 ATTGATTCTTTCCTCAAGGAGGG - Intergenic
936945941 2:117930831-117930853 ATTTAATTAGACCTCAAGATGGG + Intronic
937667405 2:124502563-124502585 AATGATACTGACCTCAGGAAAGG + Intronic
938207685 2:129438112-129438134 ATTTATTCTGACATCGTGGAAGG + Intergenic
939712017 2:145533715-145533737 ATGTATTCTGAACTAAACAAAGG - Intergenic
939758852 2:146149536-146149558 ATTTATTTTGAATACAAGAAAGG + Intergenic
941427285 2:165364321-165364343 ATGTATGCTGATCCCAAGAATGG + Intronic
943851409 2:192727848-192727870 ATTGATTCTGACATCAAGCTGGG + Intergenic
944430528 2:199628632-199628654 ATTTATTCTGAATGCAAAAAGGG + Intergenic
945104600 2:206298484-206298506 ATTTATACTGACCCCAGGATAGG - Intronic
945576862 2:211542124-211542146 AATTACTTTCACCTCAAGAAGGG + Intronic
945821321 2:214669258-214669280 ATTTTTTCTGTCCTCATTAAAGG - Intergenic
946109218 2:217399309-217399331 ATGTTTTCTGACCTCCAGAAAGG - Intronic
948539850 2:238682839-238682861 AATTATTCTGAACTGAAGACTGG - Intergenic
1172409673 20:34711715-34711737 ATTCAGTCTCACCACAAGAAGGG - Exonic
1173997020 20:47346229-47346251 TTTGATTCTGACCACAACAAGGG + Intronic
1175197844 20:57257230-57257252 ATTTATACTGACCAGATGAAGGG + Intronic
1177075359 21:16564601-16564623 ATATATTGTCAGCTCAAGAATGG + Intergenic
1177594848 21:23225233-23225255 ATTAATTCTGACCCCAAATAAGG + Intergenic
1178608722 21:34061410-34061432 TTTGATTCTGCCCTCATGAATGG + Intergenic
1179295086 21:40054551-40054573 GTTTATCCAGACCACAAGAAAGG + Intronic
1181828546 22:25539792-25539814 ATACATTCTGCCCTCAAGGAGGG - Intergenic
1182533509 22:30981564-30981586 ATTTATCCTGGCCACAAAAAGGG - Intergenic
1183412265 22:37661803-37661825 TGTTCTTCTGAGCTCAAGAATGG - Intronic
1184936425 22:47726952-47726974 ATTTATACAGAGTTCAAGAATGG + Intergenic
957136229 3:76293261-76293283 ATTTATTTTGCCCTTTAGAAGGG - Intronic
958145397 3:89617100-89617122 ATTTTTCCTGACCTGAAGAAAGG - Intergenic
958440804 3:94154174-94154196 ATCTATTTTGACCTCATGAGTGG + Intergenic
958469709 3:94501835-94501857 ATTTAAACTGACTTTAAGAAGGG - Intergenic
961066037 3:123878396-123878418 ATGTAGTCTGACCCCAGGAAAGG + Intronic
961128043 3:124439027-124439049 ATGTGCTCTGACCTTAAGAAAGG - Exonic
963365921 3:144334265-144334287 ATTTATTCTCACAACCAGAAGGG - Intergenic
964169517 3:153753015-153753037 ATTTAATCTGCCTTCTAGAAAGG + Intergenic
965962743 3:174447891-174447913 ATATTTTCTGACCCCAGGAAAGG + Intronic
966507469 3:180722844-180722866 ATTTATTCTTACTTTAAAAATGG + Intronic
966565632 3:181377853-181377875 ATGTCATCTGACCTCAAGAATGG - Intergenic
967370595 3:188740996-188741018 ATTTATTTTCTCCTCCAGAAAGG - Intronic
967943491 3:194784298-194784320 ATTTATTCTTACCTCAGCAAGGG - Intergenic
971109988 4:23574065-23574087 TTTTCTTGGGACCTCAAGAAGGG - Intergenic
972430386 4:38975954-38975976 AGTCTTTCTGACCTCAGGAAGGG - Intronic
972835473 4:42865231-42865253 ATTTATTTTTTCCTCAATAAAGG + Intergenic
974343473 4:60645660-60645682 ATTTATTCTCTTCTCAAGACAGG + Intergenic
974827104 4:67145120-67145142 ATATATTCTGACTGCAAAAAAGG - Intergenic
975974276 4:80077095-80077117 TTTCAATCTGACATCAAGAATGG + Intronic
978547641 4:109889835-109889857 ATTTATTTTGAAATGAAGAAAGG - Intergenic
980181284 4:129404401-129404423 ATTTAGGCCTACCTCAAGAAAGG + Intergenic
980245445 4:130233782-130233804 AGCTATTCTGATGTCAAGAAAGG + Intergenic
980752145 4:137105131-137105153 ATCTGTTCAGACCTCAAAAAAGG - Intergenic
981398289 4:144280553-144280575 ATTGATTCTGGCCACAATAAGGG - Intergenic
981547198 4:145905707-145905729 GTTTAATCTGAAATCAAGAAAGG - Intronic
983429118 4:167625272-167625294 ATTTCTTCTCACCTAAACAAAGG + Intergenic
983656016 4:170085635-170085657 ATAAATTCTTTCCTCAAGAAAGG - Intronic
984456601 4:179977236-179977258 AGGAATTCTGACCTCTAGAATGG - Intergenic
986621489 5:9680328-9680350 AGATATTCTTTCCTCAAGAAGGG + Intronic
987209857 5:15669851-15669873 ATATACTCTTCCCTCAAGAAGGG - Intronic
987688460 5:21235499-21235521 CTTTATTCTGCCCCCAGGAAAGG - Intergenic
990675512 5:58180193-58180215 TTTTTTTCTGACCTTAAGAATGG - Intergenic
991101074 5:62793887-62793909 ATTTATTCTGACCCCCTAAATGG + Intergenic
992500629 5:77339242-77339264 TTTCATTATGACCTCAACAACGG - Intronic
992526644 5:77618136-77618158 ATTGATGCTAACCTCAGGAACGG - Intronic
994069685 5:95586948-95586970 ATTTATTCACACATAAAGAAAGG + Intronic
995884575 5:116879208-116879230 AGTTATTCTGACCACTTGAAAGG + Intergenic
995968477 5:117938733-117938755 ATATACTATGACCTCATGAAGGG - Intergenic
996524143 5:124459943-124459965 TTTTCTTCTGACCTCAAAGATGG - Intergenic
998098289 5:139410528-139410550 ATTTATTCTGCCCTCATTTAAGG - Exonic
1002039049 5:176497475-176497497 ATATATTCTTACATAAAGAAGGG - Intronic
1002654551 5:180734142-180734164 AGATATTCTGACCACAAAAATGG - Intergenic
1005290980 6:24378477-24378499 AATTAGTCTGACCTAAAGCAAGG - Intergenic
1005889989 6:30129144-30129166 AGTTATTCTGACATCAGAAAAGG - Intergenic
1007446013 6:41906825-41906847 ATTTGGCCTGTCCTCAAGAATGG - Exonic
1007755326 6:44095727-44095749 ATTTTTACAGACCCCAAGAATGG + Intergenic
1007911954 6:45524620-45524642 ATTTATTGTGACCACATCAATGG - Intronic
1008103143 6:47414282-47414304 AAGTATTCTTACCTCAGGAAGGG + Intergenic
1008598621 6:53066470-53066492 ATTTATTCTAAACCAAAGAAAGG - Intronic
1009365320 6:62853359-62853381 ATTGTTTCTGAAATCAAGAAGGG + Intergenic
1011259701 6:85458148-85458170 AATTTTTCTTTCCTCAAGAAAGG - Intronic
1011789904 6:90886420-90886442 CTGTATCCTCACCTCAAGAAAGG - Intergenic
1011998231 6:93620310-93620332 ATTTTTTCTGGCCTTAACAAAGG - Intergenic
1012654811 6:101803774-101803796 ATTTATTTTGAATTCAAGACAGG - Intronic
1013393139 6:109706822-109706844 ATTTTTTAAGTCCTCAAGAAGGG + Intronic
1014153540 6:118085938-118085960 ATTTTTCATGAACTCAAGAAGGG - Intronic
1015571547 6:134626364-134626386 ATTAATTCAGACTTCATGAAAGG - Intergenic
1016286463 6:142478755-142478777 AATTATTCTCACCACAAAAAAGG - Intergenic
1018415241 6:163595371-163595393 TTTTTTTCTTTCCTCAAGAATGG - Intergenic
1018610918 6:165647072-165647094 ATTTACTCTAACTTGAAGAAAGG - Intronic
1019838515 7:3414909-3414931 ATTTTTTCAGCCATCAAGAATGG - Intronic
1021850718 7:24805929-24805951 ATTTATTTTGCCATAAAGAAGGG + Intronic
1022038511 7:26557009-26557031 ATCTATTTTCACCTCAGGAAAGG - Intergenic
1022325752 7:29330721-29330743 ATGTATTCTGAGCACAAGCAAGG - Intronic
1022878957 7:34565819-34565841 ACTCATTCTTACCTCAAGGATGG + Intergenic
1026653024 7:72232124-72232146 GTTTCTTCTGACCCCTAGAATGG - Intronic
1027409465 7:77899651-77899673 GTTAATTCTGACCTCAAATATGG + Intronic
1030043337 7:105472120-105472142 TTTTATTCTCACCTCCAGAGCGG + Exonic
1030107708 7:106000445-106000467 AAATATTCTGAGCTCACGAAAGG + Intronic
1030494628 7:110283486-110283508 ATTTATTATGACTTGAGGAAAGG + Intergenic
1031181817 7:118428723-118428745 ATTTATTCTGTGGTTAAGAAAGG - Intergenic
1031295851 7:120002839-120002861 AATTATTCTTACCACAAGAAAGG - Intergenic
1032124804 7:129185706-129185728 GTATATTCTCCCCTCAAGAAGGG + Intergenic
1032272830 7:130426839-130426861 ATTTATTCGGAGTTCAATAAAGG - Intronic
1032357984 7:131227953-131227975 ATTTATTCTGTCCCCCAGTAGGG + Intronic
1032713014 7:134478941-134478963 ATTTATTATCAGTTCAAGAAAGG - Intergenic
1033489805 7:141832109-141832131 ATTTAACCTTACCTAAAGAAAGG + Intergenic
1034692449 7:153024564-153024586 ATTTTTTCTGTCCTAGAGAATGG - Intergenic
1036603190 8:10282377-10282399 ATTTATACTGACCTCCATAATGG + Intronic
1038385004 8:27135403-27135425 ATATATTCTGAACTAAAGCAGGG - Intergenic
1039681570 8:39743541-39743563 ATTTTTGCTGACCTCATGAAAGG + Intergenic
1039761457 8:40581006-40581028 ATTTATGCTTACTTGAAGAATGG - Intronic
1040583689 8:48719421-48719443 GTTGATACTGGCCTCAAGAAAGG - Intronic
1041061774 8:54041640-54041662 ATTTTTCCGGACTTCAAGAAAGG - Intergenic
1041693154 8:60709675-60709697 ATTTATTCATATCTCAAAAAAGG + Intronic
1041761314 8:61369837-61369859 ATGTATTTTGACCTCTAGACTGG - Intronic
1042756173 8:72214241-72214263 TTTTATTCTGACAACAAGAAAGG + Intergenic
1043001838 8:74769041-74769063 AGATACTCTGCCCTCAAGAAGGG - Intronic
1043187999 8:77179566-77179588 ATTTATTAAGCCCTCCAGAAAGG + Intergenic
1043334795 8:79161916-79161938 ATTTTTTCTGACCTAAATAGTGG - Intergenic
1043549913 8:81359701-81359723 GTTTATTCTGACCTGTAGATAGG - Intergenic
1043935978 8:86142944-86142966 ACTCTTTCTTACCTCAAGAATGG - Exonic
1045503133 8:102758390-102758412 CTTTATTTTGAGCTCCAGAAGGG - Intergenic
1046678234 8:117137006-117137028 ATTTATTCTGACCTCAAGAAAGG - Intronic
1050260222 9:3833785-3833807 AGTTATTTTGCCTTCAAGAATGG + Intronic
1051394941 9:16609706-16609728 ATTTAAACTAATCTCAAGAAAGG + Intronic
1052384017 9:27804141-27804163 TTTTATTCTAACCTGAAGGAAGG - Intergenic
1055344280 9:75317996-75318018 GTTTATTCTGACCCCAGGAGGGG + Intergenic
1055929966 9:81550008-81550030 TTTGATTCTGGCCTCAAGCAGGG + Intergenic
1056870101 9:90269142-90269164 ATTTATTTTGAGTTCAAGAAAGG - Intergenic
1057558371 9:96107733-96107755 ATTTGTTCTGACCCCCAGAAGGG + Exonic
1058018274 9:100061634-100061656 ATTTATTCTGTTCTTAGGAAAGG + Intronic
1059284866 9:113163590-113163612 ACTTATTCTCTCCCCAAGAAAGG - Exonic
1059580459 9:115541729-115541751 ATTTCTTCTGAACTCAGGGAGGG - Intergenic
1186527597 X:10263656-10263678 ATTTAGGCTGACATTAAGAAAGG + Intergenic
1188182799 X:27075988-27076010 AGTTAATCTGAGTTCAAGAATGG + Intergenic
1189544921 X:42032958-42032980 ATATGTTCTGACCCCAAGAGAGG + Intergenic
1190702800 X:53000728-53000750 ATTTATTCAGATCTGTAGAACGG + Intergenic
1193213284 X:78834006-78834028 CATAATTTTGACCTCAAGAATGG + Intergenic
1193427966 X:81363635-81363657 AATTATTCTGACCTACAGATTGG + Intergenic
1195062325 X:101208313-101208335 ATTAATTCTGACCTCAAAAGGGG - Intergenic
1195964875 X:110420808-110420830 TTTTATTCTGACCAGATGAATGG + Intronic
1199833832 X:151569004-151569026 AAGAATTCTGACCTCAAGAGGGG + Intronic
1201249239 Y:12039540-12039562 ATTGAGTGTGAGCTCAAGAAGGG + Intergenic