ID: 1046678237

View in Genome Browser
Species Human (GRCh38)
Location 8:117137027-117137049
Sequence ATGTGTTTCTTGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046678234_1046678237 -2 Left 1046678234 8:117137006-117137028 CCTTTCTTGAGGTCAGAATAAAT 0: 1
1: 0
2: 0
3: 16
4: 212
Right 1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG No data
1046678232_1046678237 14 Left 1046678232 8:117136990-117137012 CCAGATAGAACAAATGCCTTTCT 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046678237 Original CRISPR ATGTGTTTCTTGAGGGCAGA TGG Intronic
No off target data available for this crispr