ID: 1046678348

View in Genome Browser
Species Human (GRCh38)
Location 8:117137976-117137998
Sequence GGGTAAAAAAATATGGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 294}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046678348_1046678354 10 Left 1046678348 8:117137976-117137998 CCATGAACCATATTTTTTTACCC 0: 1
1: 0
2: 2
3: 29
4: 294
Right 1046678354 8:117138009-117138031 CTCCAAATCTGTTTCATTGGTGG No data
1046678348_1046678353 7 Left 1046678348 8:117137976-117137998 CCATGAACCATATTTTTTTACCC 0: 1
1: 0
2: 2
3: 29
4: 294
Right 1046678353 8:117138006-117138028 TCTCTCCAAATCTGTTTCATTGG No data
1046678348_1046678359 27 Left 1046678348 8:117137976-117137998 CCATGAACCATATTTTTTTACCC 0: 1
1: 0
2: 2
3: 29
4: 294
Right 1046678359 8:117138026-117138048 TGGTGGGATTCTCTGGGCTTTGG No data
1046678348_1046678355 11 Left 1046678348 8:117137976-117137998 CCATGAACCATATTTTTTTACCC 0: 1
1: 0
2: 2
3: 29
4: 294
Right 1046678355 8:117138010-117138032 TCCAAATCTGTTTCATTGGTGGG No data
1046678348_1046678357 20 Left 1046678348 8:117137976-117137998 CCATGAACCATATTTTTTTACCC 0: 1
1: 0
2: 2
3: 29
4: 294
Right 1046678357 8:117138019-117138041 GTTTCATTGGTGGGATTCTCTGG No data
1046678348_1046678358 21 Left 1046678348 8:117137976-117137998 CCATGAACCATATTTTTTTACCC 0: 1
1: 0
2: 2
3: 29
4: 294
Right 1046678358 8:117138020-117138042 TTTCATTGGTGGGATTCTCTGGG No data
1046678348_1046678360 28 Left 1046678348 8:117137976-117137998 CCATGAACCATATTTTTTTACCC 0: 1
1: 0
2: 2
3: 29
4: 294
Right 1046678360 8:117138027-117138049 GGTGGGATTCTCTGGGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046678348 Original CRISPR GGGTAAAAAAATATGGTTCA TGG (reversed) Intronic
906167468 1:43697563-43697585 GGGTAAGATAATATGGTATAAGG + Intronic
907726677 1:57026649-57026671 GGATAAAAAAATGTGGTTGGAGG + Intronic
910644427 1:89498104-89498126 GGGTACAAAAATATAGTTAGAGG + Intergenic
912019973 1:105096170-105096192 GGTTTAAAAAATCTGGTTCGTGG + Intergenic
912661843 1:111538732-111538754 GGGGAATAAAAAAGGGTTCACGG + Intronic
912927410 1:113925453-113925475 GGGTAATAAAATGTTCTTCATGG - Intergenic
914046564 1:144098377-144098399 GGGGAAAAAAAGAGGGTTCTGGG - Intergenic
914131546 1:144862309-144862331 GGGGAAAAAAAGAGGGTTCTGGG + Intergenic
916358400 1:163939029-163939051 AGGTACAAAATTATTGTTCATGG + Intergenic
917313737 1:173703631-173703653 GTGGAAAGAAAAATGGTTCAAGG - Intergenic
917659849 1:177166716-177166738 GGGCAAAGAAATCTTGTTCATGG - Intergenic
917785698 1:178455063-178455085 TAGTAAAAAAATTTGTTTCATGG - Intronic
919181806 1:194094603-194094625 GAGGAAAAAAATATGTTTAATGG - Intergenic
923310790 1:232733214-232733236 GGGCAAAGAAATATGGAGCAAGG - Intergenic
1064160807 10:12944117-12944139 GGGTAAAATAATTTCCTTCAGGG - Intronic
1065777472 10:29134269-29134291 GGGTAAAATAAAATGATGCATGG - Intergenic
1067272075 10:44800994-44801016 GAGCAAAAAAAAATGATTCATGG + Intergenic
1071057938 10:81532302-81532324 GGGGAAAAAAATATAGTTACAGG - Intergenic
1072343869 10:94483131-94483153 GGTAAAGAAAATGTGGTTCAAGG - Intronic
1072985797 10:100139104-100139126 CTGTCAAAAAATATGGCTCATGG + Intergenic
1073396063 10:103218585-103218607 GGGTAAAATAATTTCTTTCAGGG + Intergenic
1073666447 10:105539473-105539495 GGGTAAAAAAATTGTCTTCAGGG + Intergenic
1074202675 10:111252978-111253000 GGCTAAAAAAATAGAATTCATGG + Intergenic
1074231643 10:111542519-111542541 GGGTAAAAAAATGTTGATAAAGG + Intergenic
1074916385 10:117960042-117960064 GGGTAAAAAAGAAGGGTTCAGGG + Intergenic
1075435205 10:122434302-122434324 GGCTAACAATACATGGTTCAAGG + Exonic
1078958101 11:16226720-16226742 GGGTGAAGAAATATGGTGGAAGG - Intronic
1079837787 11:25355846-25355868 GGCTAAAGAAATAAGCTTCAAGG + Intergenic
1080140997 11:28919959-28919981 GGGGAAAAAAATGTGGCTTAAGG - Intergenic
1080514719 11:33009634-33009656 GGGAAAAAAAAAATGATGCAGGG + Intergenic
1080654861 11:34250989-34251011 GGGTAAAAACACATGTTTGATGG - Intronic
1080881712 11:36327462-36327484 GGGTAAAATAATTTCTTTCAGGG - Intronic
1080916135 11:36662174-36662196 GGGAAAAATATTATGGTCCAAGG + Intergenic
1081038476 11:38180051-38180073 GGGGAAGAAAATATGGGTAAGGG + Intergenic
1081226889 11:40534969-40534991 GGGTCTAAACATATGGTCCATGG + Intronic
1081718407 11:45267878-45267900 GGATAACAAAAGATGGTACAAGG - Intronic
1086683799 11:89707062-89707084 GGTTCACAAAGTATGGTTCAGGG + Intergenic
1086841533 11:91690945-91690967 AGGTAAAATAATGTGGTTTATGG - Intergenic
1087949766 11:104206612-104206634 GGGTAAAGAAAAATGGTTCAAGG + Intergenic
1089236081 11:117026944-117026966 GGGTAAAAACATATTATTCAAGG + Intronic
1089872853 11:121692244-121692266 GATTGAAAAACTATGGTTCATGG + Intergenic
1090121625 11:124035370-124035392 GGGTAAAATTATTTGGTTGAAGG - Intergenic
1090525673 11:127532393-127532415 GGCTTAAAAAATATGATACATGG - Intergenic
1092162940 12:6325971-6325993 GGGTAAAAATATCTGGTTCATGG + Intronic
1093449135 12:19295843-19295865 GGGTAAAATACTATCTTTCATGG - Intronic
1093599003 12:20999357-20999379 GGGTGAAAAAAGATATTTCATGG - Intergenic
1093663720 12:21787455-21787477 GAGTAACAAAATATAATTCAGGG - Intergenic
1093885875 12:24459836-24459858 GTTTAAAAAAATATATTTCAGGG + Intergenic
1093909699 12:24732302-24732324 GAGTAAAAAACTAAGGTTCAGGG + Intergenic
1095315903 12:40760747-40760769 GGATAAAAAAATAGAGTTCAGGG - Intronic
1095857631 12:46878166-46878188 ATGTAACAAAAAATGGTTCATGG + Intergenic
1096162269 12:49388674-49388696 GGAAAAAAAAATGTGGTTCAAGG - Intronic
1096657826 12:53102732-53102754 AGGTAAAATCACATGGTTCAGGG - Intergenic
1097826913 12:64183588-64183610 TGGAGAAAGAATATGGTTCAGGG - Intergenic
1098221837 12:68278358-68278380 GGGGGAAAAAAGATGGTTTAGGG + Intronic
1098467303 12:70801956-70801978 GGGTAAAAACAGATGGTGCAGGG + Intronic
1099984899 12:89650831-89650853 GTGTAAAAATATAAGGATCAAGG + Intronic
1099992758 12:89743298-89743320 GGGCAAAGAAGTATGGTTAATGG + Intergenic
1100081526 12:90857902-90857924 GGGTAAACAAATAAATTTCAAGG + Intergenic
1101454051 12:104811071-104811093 GGGAAAAATAAAATTGTTCATGG + Intronic
1106166254 13:27249290-27249312 GTGCAAAAAAATATAGTGCATGG + Intergenic
1108807371 13:54175841-54175863 GGGTAAAGTAATATGGCCCAGGG - Intergenic
1108929102 13:55793316-55793338 GGATAAAATAACATGGATCAGGG + Intergenic
1109186804 13:59279319-59279341 AGGTAAAAAACTATGGTTTGAGG - Intergenic
1109722969 13:66299892-66299914 GGGAAAAAAAAAATGTTTCCAGG + Intergenic
1109993252 13:70086939-70086961 TGGTAAAGCAATATGGGTCAGGG + Intronic
1110947305 13:81438860-81438882 GGGAAAAAAAATAAAGTTTATGG + Intergenic
1111296601 13:86287212-86287234 GGGAAAAAAAAAATGGTTCCTGG - Intergenic
1111518930 13:89373942-89373964 GTGTAAAAATTTATTGTTCAAGG - Intergenic
1111539626 13:89653752-89653774 GGGCAAAAATAAATGATTCAAGG + Intergenic
1111570519 13:90078234-90078256 GGATTAAAAAATATGGTACACGG - Intergenic
1112039796 13:95535517-95535539 AGACAAACAAATATGGTTCATGG + Intronic
1112133845 13:96553450-96553472 GGGCAAAAAGATAGGGTTCCAGG + Intronic
1112382721 13:98907796-98907818 AGGTAGAAAAATGTGGTTCAGGG + Intronic
1112835562 13:103510086-103510108 GGAAAAAAAAATATGGCACAAGG + Intergenic
1113107733 13:106789583-106789605 AGATAAATAAATATGTTTCAGGG - Intergenic
1113150333 13:107256380-107256402 TGGCAAAAAAATATAGATCAGGG + Intronic
1114308481 14:21444623-21444645 GGGAAAAAAAATATGTTTGAGGG - Intronic
1114792166 14:25671853-25671875 GGGTACCGAAATATGCTTCATGG - Intergenic
1116372209 14:44150381-44150403 GAGTAAAAATATAGGCTTCACGG - Intergenic
1117701834 14:58421798-58421820 GGGTAATAAAATATGCATTAAGG + Intronic
1118464889 14:66022099-66022121 CAGGAAAAAAATATTGTTCAGGG + Intergenic
1118487871 14:66231065-66231087 GGTTAACAAACTATGGTCCATGG - Intergenic
1118505171 14:66403324-66403346 GGTTAAAAAAAAATCGTCCAGGG - Intergenic
1119656793 14:76422876-76422898 GTGTAAACAAAAATGTTTCACGG - Intronic
1120602367 14:86527333-86527355 AGGTAATAAAATAGGGCTCATGG + Intergenic
1120718388 14:87864840-87864862 GGGTAAATAAAAATGACTCAGGG + Intronic
1120821394 14:88914887-88914909 GGGTTTAAAAATATGGGGCAGGG - Intergenic
1124103660 15:26717719-26717741 GGGAAGAAAAATATGGAGCAAGG - Intronic
1124870874 15:33541086-33541108 GGGTTAAAAAAAAAAGTTCAGGG - Intronic
1126522550 15:49613046-49613068 GGGTACAAAAATATAGGTTAGGG + Intronic
1127828811 15:62731398-62731420 GGGAAAAAAAACATAATTCAGGG - Intronic
1131648855 15:94376797-94376819 AGGCAAAAAAATATGCTTCATGG + Intronic
1131856313 15:96599957-96599979 GAGAAAAAAAATAAAGTTCAGGG - Intergenic
1133612185 16:7443575-7443597 GGCTTAAAAATTATGTTTCAAGG - Intronic
1136866585 16:33763066-33763088 GGGTAATAATATATCCTTCAAGG - Intergenic
1137645297 16:50067960-50067982 GGGTACAAACAAAGGGTTCAGGG + Intronic
1138322941 16:56133906-56133928 GTGTAAATAAATATTTTTCATGG + Intergenic
1139384662 16:66558234-66558256 TGATAACAATATATGGTTCAGGG - Exonic
1140761843 16:78116355-78116377 AGGTAAAAATACATTGTTCAAGG + Intronic
1141735596 16:85850341-85850363 GGGGAAAAAAATGTGGAACATGG - Intergenic
1142400247 16:89854789-89854811 GGGTCATAAAATATGGATTAGGG + Intronic
1203105574 16_KI270728v1_random:1353131-1353153 GGGTAATAATATATCCTTCAAGG + Intergenic
1203127940 16_KI270728v1_random:1609237-1609259 GGGTAATAATATATCCTTCAAGG - Intergenic
1145087344 17:19953168-19953190 TGGTAAAAGAATAAGATTCAAGG + Intronic
1145855057 17:28147477-28147499 GGTTAAACAAATATTGATCATGG + Intronic
1145879880 17:28345221-28345243 GGGTAGAAAGACATGGGTCAAGG - Exonic
1146784736 17:35709403-35709425 GGTTAAAAAAAAATGGGTTAAGG + Intronic
1146823311 17:36001762-36001784 AGATAAAAAAAAATGTTTCAAGG + Exonic
1147203040 17:38816680-38816702 GGGGAAAAAAAAAAGGGTCATGG - Intronic
1150547458 17:66174717-66174739 GTGAAAACAAATATTGTTCAAGG + Intronic
1153136459 18:1923237-1923259 GGGTTAAAAAAAATGCTTCCTGG - Intergenic
1153907683 18:9677474-9677496 GGATTAAAAAATAAGATTCAAGG - Intergenic
1154296543 18:13155564-13155586 GGGTAGAAAAAGATATTTCATGG - Intergenic
1154299836 18:13183375-13183397 GGTTAAAAAAATATATTACATGG - Intergenic
1154996970 18:21649637-21649659 AAGTTAAAAAATATGATTCAGGG + Intergenic
1155013608 18:21808773-21808795 GGGGAAAAAAATAGAGTCCACGG - Intronic
1156348336 18:36279786-36279808 GTCCAAAAAAAAATGGTTCATGG + Intergenic
1156544680 18:37952387-37952409 GGGTAAAAAAGTATGGTCTTTGG - Intergenic
1157824806 18:50803208-50803230 GGGTTTAAAAAAATGGTTGAAGG + Intronic
1157859830 18:51131685-51131707 AGGGGAAATAATATGGTTCAGGG - Intergenic
1159248782 18:65846307-65846329 GGGGTAAAAAATATGGTGCTGGG - Intronic
1159556820 18:69954607-69954629 GGATAAAGAAATGAGGTTCATGG + Intronic
1159568086 18:70078907-70078929 GGGTCAAAAGATATGATGCATGG + Intronic
1161611334 19:5244637-5244659 GGGTAACAAACTATGGCCCAGGG + Intronic
1162648669 19:12068325-12068347 GATTCAAAAAATATGGTTAAAGG + Intronic
1164136910 19:22424577-22424599 GGGTGAAAACAATTGGTTCAGGG - Intronic
1164138160 19:22433049-22433071 GAGTAAAAACAATTGGTTCAGGG + Intronic
1164161994 19:22633185-22633207 GGGTGAAAACAATTGGTTCAGGG + Intergenic
1164313310 19:24065128-24065150 GGATAAAAAAATATATTCCAAGG - Intronic
1164429390 19:28173738-28173760 AACTAAAATAATATGGTTCAAGG - Intergenic
1164442072 19:28286493-28286515 GGGTTAAATATTATGTTTCAGGG - Intergenic
1202686118 1_KI270712v1_random:51791-51813 GGGGAAAAAAAGAGGGTTCTGGG - Intergenic
926291639 2:11535906-11535928 GGGAAAAAAAAAAGAGTTCAGGG - Intronic
927253773 2:21021628-21021650 AGGTAAAGGAATATGGTTCAAGG - Intronic
927595429 2:24392790-24392812 GGGCAGAAAAATATGGCTAATGG - Intergenic
927995217 2:27480414-27480436 GAGCAAAAAAATATGGAACAAGG + Intronic
930351142 2:50256273-50256295 GGGTAAAAACGTTTGGTACATGG - Intronic
933368565 2:81387003-81387025 GGCTATAAAAATCTGCTTCAGGG + Intergenic
933571428 2:84017914-84017936 GGAAAAAATAATATGGTTCATGG + Intergenic
933860067 2:86457774-86457796 GGGTAAACAAATGTATTTCAAGG + Intronic
933897945 2:86827643-86827665 GGGTAGACAAATATGGGGCAGGG + Intronic
934101308 2:88655874-88655896 GGGTAAAATAATATGGCTGAGGG + Intergenic
934137815 2:89015125-89015147 GGGTACAGAAATATGGCTTAGGG + Intergenic
934245604 2:90303029-90303051 GGGGAAAAAAAGAGGGTTCTGGG + Intergenic
934263142 2:91494010-91494032 GGGGAAAAAAAGAGGGTTCTGGG - Intergenic
934540918 2:95174271-95174293 GGGTCAAACAGTATGTTTCAAGG + Intronic
934635275 2:95981649-95981671 GGGTAATAATATATCCTTCAAGG - Intronic
934798355 2:97123570-97123592 GGGTAATAATATATCCTTCAAGG + Intronic
934835074 2:97579858-97579880 GGGTAATAATATATCCTTCAAGG - Intronic
934870337 2:97859129-97859151 GAGAAAAACAATATGGTTAAGGG + Intronic
935436400 2:103039323-103039345 CTTTAAAAAATTATGGTTCATGG - Intergenic
936260581 2:110956843-110956865 GGATCATAAAATATGTTTCATGG + Intronic
936744437 2:115557723-115557745 TGGTAAAGAAAGATGGATCAAGG + Intronic
937523273 2:122736940-122736962 TGGCAAAGAAATATGTTTCATGG - Intergenic
937596480 2:123681279-123681301 TTGTAAAAAAATCTGGTTCCTGG + Intergenic
937628054 2:124066141-124066163 GGGTAAGAAAGTAGGGTTAATGG + Intronic
938646899 2:133341133-133341155 GGGTAAAAGAATGTGGTTGTAGG - Intronic
940663861 2:156582387-156582409 GGGTAGACAAATATAGGTCATGG + Intronic
941057707 2:160807397-160807419 GGGAAGAAAAATAGGTTTCATGG + Intergenic
941481649 2:166023306-166023328 GGGTGAAAAAATAAGGTTGTTGG - Intronic
941521536 2:166550412-166550434 GGATAAAGAAATGTGGTACATGG - Intergenic
941596622 2:167484881-167484903 GGGTAAAATAATTTCTTTCAGGG + Intergenic
941725385 2:168854580-168854602 GGGGAAGAAAAAATTGTTCAGGG - Intronic
943986510 2:194627513-194627535 GGGTAAAACAATATATTTCCAGG - Intergenic
945985337 2:216349226-216349248 GGTTAAAAACATAAGTTTCAGGG + Intronic
946043346 2:216801201-216801223 GGGGAAAAAAATATCATTCAGGG + Intergenic
947755909 2:232565004-232565026 GGGTAAGAAAATAAGTTTAAAGG + Intronic
948232397 2:236359593-236359615 GAGCAGCAAAATATGGTTCATGG - Intronic
1169434522 20:5573860-5573882 AGGTAGAGAAATATGGATCAGGG - Intronic
1169800016 20:9505324-9505346 GGCTAATTAAGTATGGTTCAAGG + Intergenic
1173749532 20:45466440-45466462 GTGTAAAAAAATATATATCAGGG - Intergenic
1177342487 21:19823337-19823359 ATATTAAAAAATATGGTTCATGG + Intergenic
1178142899 21:29703945-29703967 GGATAAGAAAATATGGAGCAAGG + Intronic
1178821807 21:35982317-35982339 GGGTATGAAAATATGTGTCATGG - Intronic
1178908201 21:36653499-36653521 GGGAAAAAAAACATGGTCCGTGG - Intergenic
1182559866 22:31151252-31151274 GGGTGAATAAATGTGGTACAGGG + Intergenic
1183383583 22:37502729-37502751 GGGAAAAAGAATGAGGTTCAGGG + Intronic
949291447 3:2471386-2471408 GAGTTAAAAAATATGGTTAAGGG + Intronic
949662287 3:6292838-6292860 GGGAAGAAAAATATGTTTAATGG + Intergenic
949682236 3:6527549-6527571 GGCTAGTAAACTATGGTTCAAGG - Intergenic
950774669 3:15339065-15339087 GGGTTAAAAAATATTGTTGAAGG - Intronic
951234354 3:20217361-20217383 AGGTAAAAAGAAATGGTGCAGGG + Intergenic
951280051 3:20737216-20737238 GGGCAGAAAAATATGTTTAAGGG + Intergenic
951959731 3:28303926-28303948 GGATAAGAAAATATGTTCCAAGG + Intronic
951994874 3:28716113-28716135 AGATAAATAAATGTGGTTCATGG + Intergenic
952529959 3:34253265-34253287 GGGGAAAAAATAATGTTTCAAGG + Intergenic
952998472 3:38908059-38908081 GGGTAAAATATGATGTTTCAAGG + Exonic
955123335 3:56083905-56083927 GGGAAAAAAAAAATGGAACAGGG + Intronic
955937764 3:64118720-64118742 GGCAAAAAAAATATGGATTATGG + Intronic
956716693 3:72085867-72085889 GGGGAAGAAAGTATGGATCAGGG + Intergenic
957285550 3:78212998-78213020 GGGTAAGAAAATAAGGGTGAAGG + Intergenic
958101609 3:89019263-89019285 GAGTAAGAAAATATGGTGCTTGG - Intergenic
959230435 3:103643307-103643329 CGGTAAAAAAATATAGTGTAAGG + Intergenic
962044284 3:131739211-131739233 GAATAAAAAAAGATGGTTAAAGG - Intronic
962920105 3:139942975-139942997 GGGAAAAAAAGTATTGATCAGGG - Intronic
963937215 3:151067073-151067095 GGGTAAAAAAATATTTTGCTAGG - Intergenic
964002107 3:151787337-151787359 GGGGAAAATAATATGATTGATGG - Intergenic
964157662 3:153605155-153605177 GGGTAAAAAGAAATGGTAAACGG - Intergenic
964798869 3:160531060-160531082 GGTTAAAAAAATATGCTGGATGG - Intronic
964901760 3:161668688-161668710 GGATGGAAAAATATGGTTAATGG - Intergenic
965895610 3:173571903-173571925 GGGTAAAAAATTAAGGTTGAAGG + Intronic
968026463 3:195446735-195446757 GGTTATAAAAATAAGTTTCAGGG + Intergenic
968111725 3:196053855-196053877 GGGGAAAACATTTTGGTTCAAGG + Intronic
971268239 4:25113359-25113381 GGGTCAAAGAATATGCTCCATGG - Intergenic
971903296 4:32692212-32692234 GGGAAATAAAATATGCATCAAGG - Intergenic
972422806 4:38905494-38905516 GGAAATAAAAATATGGTTCATGG - Intronic
974255928 4:59455237-59455259 GGTAAAAAAAATATGTTTTAAGG - Intergenic
974606773 4:64162388-64162410 TAATAAAAAAATATAGTTCAGGG - Intergenic
975409256 4:74029704-74029726 GGGGAAAAAATTATTGTACATGG + Intergenic
976461048 4:85313558-85313580 GGGAAGAAAAATATGTTTAATGG + Intergenic
976517864 4:85992020-85992042 GTATAAAATTATATGGTTCAGGG + Intronic
976782219 4:88773627-88773649 GGGTAAAAAGAAAGGGTCCAAGG - Intronic
977222200 4:94351281-94351303 GGGTAAAGAAATAAGTGTCAAGG + Intergenic
978194071 4:105950256-105950278 GGGAAAAAAAATCTGTTTCCTGG - Intronic
978914574 4:114108794-114108816 GGGTAAAAAAAGATAATTCAGGG - Intergenic
978978157 4:114906614-114906636 GAGGTAAAAAAGATGGTTCATGG - Intronic
979429933 4:120617309-120617331 GGATAAAAAAGTATGGGGCATGG - Intergenic
979449179 4:120849516-120849538 GGGTAAAAACATTTGGGTCCTGG - Intronic
980323709 4:131312432-131312454 GGATAAAATAATATACTTCAAGG + Intergenic
981145663 4:141321384-141321406 GGGAAGAAAAATATGTTTAATGG + Intergenic
983228130 4:165104208-165104230 GAAAAAAAGAATATGGTTCATGG + Intronic
984495429 4:180491293-180491315 GGGGAAAAAAAAATGCTTCAAGG + Intergenic
984594044 4:181647371-181647393 GGGTAAAAATATCTATTTCATGG + Intergenic
987356164 5:17065000-17065022 GGCTAAAAAAAATTGTTTCAAGG + Intergenic
987533689 5:19155840-19155862 GGATAAAATTATATAGTTCATGG - Intergenic
988118637 5:26929884-26929906 GGGTACAAAAATATAGTTAGGGG + Intronic
988679739 5:33473294-33473316 GGGTAAAATAATCTCTTTCAGGG - Intergenic
989621066 5:43384736-43384758 GGGTAAAGAAATAAAGTTTAAGG - Intronic
989720412 5:44521705-44521727 AGGTAAAATAATATTGTTGAAGG - Intergenic
990082786 5:51937345-51937367 GGTTAAAAAAATCTGTCTCATGG - Intergenic
992110469 5:73487869-73487891 GGGTAAAATAATCTCTTTCAGGG + Intergenic
992170582 5:74097859-74097881 GGGTAAAAGAACATGCTTCAGGG + Intergenic
993110052 5:83645730-83645752 GGGAAAAAAAATAAGATTAAGGG - Intronic
994316352 5:98338637-98338659 GGGAAGAAAAATAGGGTTAATGG + Intergenic
994844359 5:104967904-104967926 GGAAAGAAATATATGGTTCAGGG - Intergenic
995835147 5:116393470-116393492 GAGTACAGAAATATTGTTCATGG - Intronic
996494207 5:124134510-124134532 GGGGAAAAAAAAATTGTTAAAGG + Intergenic
1000132636 5:158314494-158314516 AGGTCAAATAAAATGGTTCAAGG + Intergenic
1001438182 5:171717155-171717177 GGCTAAAAAAATGTTGTTAAAGG + Intergenic
1001810192 5:174621727-174621749 TGGCAACAAAATCTGGTTCAAGG + Intergenic
1004348978 6:14874443-14874465 GGGAGAAAAATTATGATTCAAGG - Intergenic
1005386581 6:25291118-25291140 GGGGAAAAAAATATGTTAAAGGG - Intronic
1007790523 6:44305840-44305862 GGGGAGAAAAATAAGGTCCAGGG + Intronic
1007859406 6:44891799-44891821 AGGAAAAAAAAGATGGTTGATGG + Intronic
1008148127 6:47916585-47916607 GGGTAAGAAAGTTTGGTTCAAGG - Intronic
1008178311 6:48295246-48295268 GGGTAATAAATTATAGATCATGG - Intergenic
1008549626 6:52615239-52615261 CTGTGAAAAAATATGGTGCATGG + Intergenic
1009377588 6:62991129-62991151 GGGGAAAAAAAAATATTTCATGG - Intergenic
1012255270 6:97023939-97023961 GTGTGAAAAAATATAGTCCAAGG + Intronic
1012380152 6:98611346-98611368 GGGTAAAAAATTAACTTTCAGGG - Intergenic
1013388397 6:109656568-109656590 GAGTAAAATAATATTGTTCTGGG + Intronic
1013648671 6:112171247-112171269 GGGTTAGAAAATAAGTTTCATGG - Intronic
1015313957 6:131795843-131795865 GGGTAAAAAGATAAGAATCATGG - Intergenic
1015427179 6:133084772-133084794 GGGTTAAAAAGAATGGTTCATGG + Intergenic
1015452426 6:133386355-133386377 AGTTAAAAAAATAAGATTCATGG - Intronic
1015757233 6:136619967-136619989 GGGAATAAAAATTGGGTTCACGG + Intronic
1016096402 6:140043105-140043127 TGGAAAAAAAATATGCTACAAGG - Intergenic
1016667741 6:146662205-146662227 GGGGCAAAAAATATAGTTGAAGG - Intronic
1019583845 7:1785135-1785157 GAATGAAAAAATATGGTACAGGG - Intergenic
1020766588 7:12329473-12329495 GGGTAAAATAATTTCTTTCAGGG + Intergenic
1021759471 7:23889522-23889544 GGGACAAAAACTATGTTTCATGG - Intergenic
1022871909 7:34488744-34488766 GGGAAGAAAAAGATGGGTCAGGG + Intergenic
1023415782 7:39930990-39931012 GGCTAAAAATAAATGGTTTAGGG - Intergenic
1024032215 7:45470839-45470861 GGAAAAAAAAGTATGGTTTAAGG + Intergenic
1024388433 7:48780036-48780058 GGGTAAAATAATTTCTTTCAGGG + Intergenic
1024731959 7:52262913-52262935 GGTTAAATAACTTTGGTTCATGG + Intergenic
1025066012 7:55856691-55856713 GGATTAAAAAATGTGGTACATGG - Intronic
1025801226 7:64788534-64788556 GTCTAAAAAAAAATGATTCAAGG + Intergenic
1025888328 7:65620834-65620856 AGGAAAAAAAAAATAGTTCAGGG + Intergenic
1026372940 7:69719817-69719839 GGGGGAAGGAATATGGTTCAGGG + Intronic
1026439904 7:70435079-70435101 GGGCAAAAAAGTATGCTTTAGGG - Intronic
1027191116 7:75995947-75995969 GGGAAAGAAAATCTGTTTCAAGG + Intergenic
1027594647 7:80158007-80158029 GCGTATAAAAATATTCTTCAGGG - Intronic
1027620696 7:80481530-80481552 GGGTAAAATAATTTCTTTCAGGG - Intronic
1028073563 7:86482529-86482551 AGCTCAAAATATATGGTTCAGGG + Intergenic
1029848763 7:103441320-103441342 GGGTAAACAAATACCTTTCATGG + Intronic
1030821845 7:114102655-114102677 GTGTAGCAAAATATGGTCCATGG - Intronic
1030926119 7:115456684-115456706 AAGTAAAGAAATATGGATCATGG - Intergenic
1030995878 7:116357845-116357867 GGGTAAAAGGATATGACTCACGG + Intronic
1031242282 7:119261755-119261777 GGGTAAACCACTATGCTTCATGG + Intergenic
1031854108 7:126901133-126901155 AGGAAAAAAAAAATAGTTCAGGG - Intronic
1033848542 7:145464997-145465019 GGGTACAAAAATATAGTTTGAGG - Intergenic
1033969268 7:147019055-147019077 GAGTTAAAAAATATAGTTTATGG + Intronic
1035838370 8:2783522-2783544 GGAGAAAAAAATATGATTCAAGG - Intergenic
1037634369 8:20688086-20688108 TGGTGAAAAAATATGCATCATGG - Intergenic
1040097495 8:43460141-43460163 GGGTGAAAAAAGTTGGTGCAAGG - Intergenic
1040892514 8:52332234-52332256 GGGTAGAAATATATGATTGATGG + Intronic
1041485212 8:58369180-58369202 TGGGAAAAAAATATGTTTCAGGG - Intergenic
1042882508 8:73509716-73509738 GTGAAAAAAAATAGGGTTTATGG + Intronic
1042998827 8:74732472-74732494 GGGTAAAAAACTAGGGTGCTGGG + Intronic
1043161159 8:76849883-76849905 TTGGAAAAAAATATGGTACAAGG + Intronic
1043416154 8:80052427-80052449 CAATAAAAAAACATGGTTCATGG + Intronic
1043788669 8:84434693-84434715 AGGTAAGAAAATATAGATCACGG + Intronic
1043974779 8:86572238-86572260 GGGAAAAAAAATATGGTGTGTGG - Intronic
1044517000 8:93151434-93151456 GGCTAGGAAAATATGGTGCATGG + Intronic
1046602821 8:116337578-116337600 GAGTTACAAAAGATGGTTCATGG + Intergenic
1046678348 8:117137976-117137998 GGGTAAAAAAATATGGTTCATGG - Intronic
1047936114 8:129780540-129780562 GGCAAAAAAAATATGCTTCAAGG + Intronic
1048699907 8:137077202-137077224 GGGAACAAAAATATGTTTAATGG - Intergenic
1050959810 9:11714725-11714747 GGGTATGAAAAGATGTTTCAGGG - Intergenic
1055754280 9:79540938-79540960 GGGTAAAAAACTAAGGCTAAAGG + Intergenic
1057897169 9:98918349-98918371 GGGAAAAAAGATATGGTTAATGG - Intergenic
1058556396 9:106173279-106173301 GGGTAAGAAAATAAGGATGAGGG - Intergenic
1060115082 9:120934051-120934073 GGTAAGAAAAATAAGGTTCAAGG - Intergenic
1060175359 9:121493648-121493670 GGGTAGAAAAAAATGGATCCTGG - Intergenic
1060620508 9:125061457-125061479 ACTTAAAAAAATATTGTTCAAGG + Intronic
1062025293 9:134337470-134337492 GGGTTAAAACATCTGGTCCAAGG - Intronic
1186724376 X:12341334-12341356 AAGAAAAAAAAAATGGTTCAAGG - Intronic
1187211754 X:17238892-17238914 GGGGAAAAAAATATGTGACAGGG - Intergenic
1187427088 X:19187843-19187865 AGGTAAGAAAATATGTTGCAAGG + Intergenic
1188763769 X:34064366-34064388 GGGTAAAAAAATAAGTTTAGAGG - Intergenic
1189748098 X:44190699-44190721 GGGGAAAAAAAAATGGCTCCAGG + Intronic
1192594325 X:72390279-72390301 GGGTACAAAAATATAGTTAGAGG - Intronic
1193291213 X:79775472-79775494 TGGTAAAGAAAGATGGTTCCTGG - Intergenic
1193706530 X:84826532-84826554 AGGTAAACAAACATGGTTTATGG - Intergenic
1194222507 X:91212979-91213001 GGGAAAAAAAATCTGGATCCTGG + Intergenic
1194441109 X:93935536-93935558 GGATAAAAAGAGATGGTTAATGG + Intergenic
1195427174 X:104747522-104747544 AAGTAAAAGAATATGGTTCGAGG + Intronic
1195959839 X:110374824-110374846 GAGTAAAGAGATAAGGTTCAAGG + Intronic
1196933486 X:120705380-120705402 TGGAAAAAAAAAATGTTTCATGG - Intergenic
1196972871 X:121128861-121128883 GGGTAAGAAAGTAGGGTGCATGG + Intergenic
1196993250 X:121351525-121351547 GGATAAAAAAATGTGGTACATGG + Intergenic
1201535190 Y:15039394-15039416 GGATAAGAAAATGTGGTACATGG - Intergenic
1201979908 Y:19895256-19895278 GGGCATAAAAATATGGTAAAGGG + Intergenic
1202585402 Y:26419532-26419554 GGGTAATAATATATCCTTCAAGG + Intergenic