ID: 1046679964

View in Genome Browser
Species Human (GRCh38)
Location 8:117157817-117157839
Sequence GTTGGCCGCCACTGCGCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046679964_1046679966 -2 Left 1046679964 8:117157817-117157839 CCAGCTGCGCAGTGGCGGCCAAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1046679966 8:117157838-117157860 ACATTGTGTAAGTCATCCCCTGG 0: 1
1: 0
2: 1
3: 8
4: 95
1046679964_1046679970 20 Left 1046679964 8:117157817-117157839 CCAGCTGCGCAGTGGCGGCCAAC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1046679970 8:117157860-117157882 GTCCCCACACACTGCTCATGAGG 0: 1
1: 0
2: 1
3: 22
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046679964 Original CRISPR GTTGGCCGCCACTGCGCAGC TGG (reversed) Exonic
900380097 1:2379627-2379649 CGTGGCCACCACTGCGCACCCGG - Intronic
901012859 1:6210974-6210996 GGTGGCCTCCACTGCCCTGCAGG - Intronic
904143193 1:28369739-28369761 GTTGGCCGCCAGGCAGCAGCCGG - Intronic
905225194 1:36474097-36474119 GTGGGCCACCACTGGGCTGCTGG - Intronic
911664716 1:100539551-100539573 GCTGGCCGCCGCGGCGCTGCTGG + Exonic
914125462 1:144813781-144813803 GCTGGCCGCCTCTCCGCCGCCGG + Intergenic
915577008 1:156786090-156786112 GTGAGCCACCACTGCCCAGCCGG + Intronic
920271032 1:204763942-204763964 CCTGGCAGCCACTGCTCAGCGGG - Intergenic
924100141 1:240594859-240594881 GTTGGTAGCCTCTGAGCAGCAGG - Intronic
1074881499 10:117663063-117663085 GATGGCTGCCACTGGACAGCTGG - Intergenic
1074882490 10:117669674-117669696 GTTGGCTGCCTCTGCCCACCAGG - Intergenic
1077132658 11:981089-981111 GTGGGCTGCCACTGTGCTGCTGG + Intronic
1078666944 11:13333639-13333661 ATGGGCAGCCACTGCGCAGATGG - Intronic
1082025061 11:47565622-47565644 GATGGCGGCCACCGCGCTGCTGG + Exonic
1092070023 12:5624673-5624695 ATTGTCCACCACTGCACAGCTGG - Intronic
1093444610 12:19242381-19242403 GATGGGCGCCACTGCACACCTGG + Intronic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1102912578 12:116728813-116728835 CTTGGCCGTCCCTGCTCAGCTGG - Intronic
1103720111 12:122969189-122969211 GTTGGCTGCCACATGGCAGCCGG - Intronic
1103903681 12:124316427-124316449 CCTGGCTGCCACTGCGGAGCAGG + Intergenic
1104679479 12:130739626-130739648 GTTGGCAGCCTCTGGGCAGGGGG + Intergenic
1105922916 13:24982318-24982340 GTTGGCTGCCTGTGCCCAGCAGG + Intergenic
1108739426 13:53320175-53320197 GTTGGCTGCCTCTGCACGGCAGG + Intergenic
1110799227 13:79675393-79675415 GGTGGCAGCCACTGTGCTGCAGG - Intergenic
1113456424 13:110452275-110452297 GGCGCCCGCCACCGCGCAGCTGG + Intronic
1113494151 13:110714388-110714410 GAGGGCCGCCGCTGCGGAGCCGG - Intronic
1113804903 13:113106938-113106960 GTTGGCCCCCACTGGGCCCCAGG - Intronic
1113988779 13:114341587-114341609 GCTGGCTGACACTGGGCAGCAGG - Intergenic
1121640423 14:95481496-95481518 GTTGGGGGCCGCTGAGCAGCAGG + Intergenic
1132318152 15:100905466-100905488 GATGGCAGCCACTGCCCAGAAGG + Intronic
1132588731 16:717219-717241 GGTGGACGCCACAGCGCAGTGGG - Exonic
1132623684 16:880084-880106 CTTGGCCGCCTGTGGGCAGCAGG - Intronic
1139884513 16:70198779-70198801 GTTGGGCTTCACTGCACAGCTGG + Intergenic
1140368008 16:74396713-74396735 GTTGGGCTTCACTGCACAGCTGG - Intergenic
1140446798 16:75035741-75035763 GTTGGCGGCCACTGCGCATGCGG - Intronic
1142704336 17:1684811-1684833 TCTGGCCGCCATTGCGCTGCGGG - Exonic
1143918093 17:10309491-10309513 GGTGGCCGCCTCTGCGTACCTGG - Intronic
1150333219 17:64311167-64311189 GTTGTCCTCCACTGCAGAGCAGG + Intergenic
1152779393 17:82219596-82219618 GGTGGCCGCCCCTGAGCAGGGGG + Intergenic
1152831075 17:82497363-82497385 GTTGTCCTCCACAGCGCGGCGGG + Intergenic
1154394341 18:13973231-13973253 GTTGGCAGCCACTGGGAGGCAGG + Intergenic
1158695019 18:59696585-59696607 GCTGTTCGCCACTGCGCACCGGG - Intronic
1160919105 19:1511677-1511699 CTTGGCCCCCACTGCACAGATGG - Intronic
1161596201 19:5152255-5152277 GGTGGCCGCCCCTGTGCACCTGG + Exonic
1161706567 19:5824976-5824998 GTTGGCCCCCGCGGCGCAGCAGG + Intronic
1161771701 19:6234284-6234306 CTTGGCCGCCCCTGCGGAGGGGG + Intronic
1166680728 19:44765008-44765030 GTTTGCCGCCACTGCATAGGAGG - Intergenic
1202693081 1_KI270712v1_random:105007-105029 GCTGGCCGCCTCTCCGCCGCCGG - Intergenic
924959019 2:17289-17311 GCTGGCTGGCACTGGGCAGCAGG + Intergenic
927081205 2:19632595-19632617 GTTGGCCACCACTCAGCTGCTGG - Intergenic
934237563 2:90245362-90245384 GCTGGCCGCCTCTCCGCCGCTGG + Intergenic
934237568 2:90245380-90245402 GCTGGCCGCCTCTCCGCCGCTGG + Intergenic
934460003 2:94208726-94208748 GCTGGCCGCCTCTCCGCCGCTGG + Intergenic
937026400 2:118701555-118701577 GTTGACCTCCACTGCACTGCTGG + Intergenic
938199172 2:129358805-129358827 GCTGGCCGCCTCTGCTCATCAGG + Intergenic
1178365382 21:31985600-31985622 GGTGGCCGGCAGTGGGCAGCCGG + Intronic
1178914713 21:36699836-36699858 GTCGGCCATCACTTCGCAGCTGG + Exonic
1179823412 21:43950654-43950676 CTTGGAGGCCACTGAGCAGCGGG - Intronic
954467849 3:50667324-50667346 TTTGGTCACCCCTGCGCAGCTGG - Intergenic
968374501 4:27706-27728 GCTGGCTGGCACTGGGCAGCAGG + Intergenic
997450372 5:133977761-133977783 AGTGGCTGCCACTGCGGAGCTGG + Intronic
999381758 5:151126300-151126322 GTTGGCCGCCAGGGGGCAGCTGG + Intronic
1003399832 6:5782422-5782444 GTTGGCTGCCTGTGCCCAGCAGG + Intergenic
1003855407 6:10268650-10268672 CTTGGTCCCCACTGTGCAGCAGG - Intergenic
1004427915 6:15518624-15518646 GGTGCCCGCCACTACGCACCCGG + Intronic
1006086374 6:31598671-31598693 GGTGGCAGCCACTTCGCTGCTGG - Intergenic
1006355817 6:33557112-33557134 GATGGCCTCCCCTGCACAGCTGG - Intergenic
1007789869 6:44302810-44302832 GCTGGCCGTCACTGGGGAGCAGG - Exonic
1009644374 6:66378342-66378364 GTTGGCCTCCAGTGCGGAGGTGG - Intergenic
1019198370 6:170295632-170295654 GCTGGCCGCGGCTGCGCCGCTGG + Intronic
1021941735 7:25685583-25685605 ATTAGCCCCCACTGCCCAGCAGG + Intergenic
1024048442 7:45601168-45601190 TATGGCCGCCCCTGTGCAGCTGG + Intronic
1026470126 7:70687993-70688015 GTTGCCCGCCACTGGGAGGCAGG - Intronic
1027978526 7:85187174-85187196 GCTGGCAGCCTCCGCGCAGCAGG - Intergenic
1044748861 8:95397349-95397371 GGTTGCCGCCACTGCCCTGCTGG + Intergenic
1046679964 8:117157817-117157839 GTTGGCCGCCACTGCGCAGCTGG - Exonic
1056797376 9:89668023-89668045 GAGGGCTGCCACTGCCCAGCAGG + Intergenic
1057533535 9:95875943-95875965 GTTGGCCGCCATTGGCCTGCCGG + Exonic
1059445835 9:114337250-114337272 GTGGGCGGCCACTTGGCAGCTGG + Exonic
1060448012 9:123709622-123709644 GTGGGCCATCACTGAGCAGCAGG - Intronic
1061554904 9:131361425-131361447 GCTGGCAGCCACTGCGCATGCGG - Intergenic
1061724801 9:132576292-132576314 GGTGGCTGCCACTGGGCAGGAGG + Intergenic
1203574721 Un_KI270744v1:166444-166466 GCTGGCCGGCACTGGGCAGCAGG - Intergenic
1192051702 X:67730280-67730302 CTTGGCCTCCACTGGGCAGCAGG + Exonic
1193483832 X:82060890-82060912 CTTGGTCCCCACAGCGCAGCAGG + Intergenic