ID: 1046681113 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:117171307-117171329 |
| Sequence | AATAAGTGGGCTGGTTTCAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 215 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 11, 4: 203} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046681113_1046681118 | 18 | Left | 1046681113 | 8:117171307-117171329 | CCTTTGAAACCAGCCCACTTATT | 0: 1 1: 0 2: 0 3: 11 4: 203 |
||
| Right | 1046681118 | 8:117171348-117171370 | ATGATACCCACGACATTCTTGGG | 0: 1 1: 0 2: 0 3: 1 4: 56 |
||||
| 1046681113_1046681117 | 17 | Left | 1046681113 | 8:117171307-117171329 | CCTTTGAAACCAGCCCACTTATT | 0: 1 1: 0 2: 0 3: 11 4: 203 |
||
| Right | 1046681117 | 8:117171347-117171369 | AATGATACCCACGACATTCTTGG | 0: 1 1: 0 2: 2 3: 16 4: 148 |
||||
| 1046681113_1046681119 | 19 | Left | 1046681113 | 8:117171307-117171329 | CCTTTGAAACCAGCCCACTTATT | 0: 1 1: 0 2: 0 3: 11 4: 203 |
||
| Right | 1046681119 | 8:117171349-117171371 | TGATACCCACGACATTCTTGGGG | 0: 1 1: 0 2: 0 3: 6 4: 63 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046681113 | Original CRISPR | AATAAGTGGGCTGGTTTCAA AGG (reversed) | Intronic | ||