ID: 1046681114

View in Genome Browser
Species Human (GRCh38)
Location 8:117171316-117171338
Sequence GACAACATCAATAAGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046681114_1046681122 23 Left 1046681114 8:117171316-117171338 CCAGCCCACTTATTGATGTTGTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1046681122 8:117171362-117171384 ATTCTTGGGGCTGACTGCAGAGG 0: 1
1: 0
2: 3
3: 32
4: 380
1046681114_1046681119 10 Left 1046681114 8:117171316-117171338 CCAGCCCACTTATTGATGTTGTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1046681119 8:117171349-117171371 TGATACCCACGACATTCTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 63
1046681114_1046681123 24 Left 1046681114 8:117171316-117171338 CCAGCCCACTTATTGATGTTGTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1046681123 8:117171363-117171385 TTCTTGGGGCTGACTGCAGAGGG 0: 1
1: 0
2: 3
3: 13
4: 167
1046681114_1046681124 30 Left 1046681114 8:117171316-117171338 CCAGCCCACTTATTGATGTTGTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1046681124 8:117171369-117171391 GGGCTGACTGCAGAGGGCTGAGG No data
1046681114_1046681118 9 Left 1046681114 8:117171316-117171338 CCAGCCCACTTATTGATGTTGTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1046681118 8:117171348-117171370 ATGATACCCACGACATTCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1046681114_1046681117 8 Left 1046681114 8:117171316-117171338 CCAGCCCACTTATTGATGTTGTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1046681117 8:117171347-117171369 AATGATACCCACGACATTCTTGG 0: 1
1: 0
2: 2
3: 16
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046681114 Original CRISPR GACAACATCAATAAGTGGGC TGG (reversed) Intronic