ID: 1046681116 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:117171321-117171343 |
Sequence | GCTATGACAACATCAATAAG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 115 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 12, 4: 101} |
Found 6 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1046681116_1046681124 | 25 | Left | 1046681116 | 8:117171321-117171343 | CCACTTATTGATGTTGTCATAGC | 0: 1 1: 0 2: 1 3: 12 4: 101 |
||
Right | 1046681124 | 8:117171369-117171391 | GGGCTGACTGCAGAGGGCTGAGG | No data | ||||
1046681116_1046681123 | 19 | Left | 1046681116 | 8:117171321-117171343 | CCACTTATTGATGTTGTCATAGC | 0: 1 1: 0 2: 1 3: 12 4: 101 |
||
Right | 1046681123 | 8:117171363-117171385 | TTCTTGGGGCTGACTGCAGAGGG | 0: 1 1: 0 2: 3 3: 13 4: 167 |
||||
1046681116_1046681119 | 5 | Left | 1046681116 | 8:117171321-117171343 | CCACTTATTGATGTTGTCATAGC | 0: 1 1: 0 2: 1 3: 12 4: 101 |
||
Right | 1046681119 | 8:117171349-117171371 | TGATACCCACGACATTCTTGGGG | 0: 1 1: 0 2: 0 3: 6 4: 63 |
||||
1046681116_1046681122 | 18 | Left | 1046681116 | 8:117171321-117171343 | CCACTTATTGATGTTGTCATAGC | 0: 1 1: 0 2: 1 3: 12 4: 101 |
||
Right | 1046681122 | 8:117171362-117171384 | ATTCTTGGGGCTGACTGCAGAGG | 0: 1 1: 0 2: 3 3: 32 4: 380 |
||||
1046681116_1046681117 | 3 | Left | 1046681116 | 8:117171321-117171343 | CCACTTATTGATGTTGTCATAGC | 0: 1 1: 0 2: 1 3: 12 4: 101 |
||
Right | 1046681117 | 8:117171347-117171369 | AATGATACCCACGACATTCTTGG | 0: 1 1: 0 2: 2 3: 16 4: 148 |
||||
1046681116_1046681118 | 4 | Left | 1046681116 | 8:117171321-117171343 | CCACTTATTGATGTTGTCATAGC | 0: 1 1: 0 2: 1 3: 12 4: 101 |
||
Right | 1046681118 | 8:117171348-117171370 | ATGATACCCACGACATTCTTGGG | 0: 1 1: 0 2: 0 3: 1 4: 56 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1046681116 | Original CRISPR | GCTATGACAACATCAATAAG TGG (reversed) | Intronic | ||