HTGT WGE

Individual CRISPR Summary

ID: 1046681118

 View in Genome Browser
Species Human (GRCh38)
Location 8:117171348-117171370
Sequence ATGATACCCACGACATTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046681116_1046681118 4 Left 1046681116 8:117171321-117171343 CCACTTATTGATGTTGTCATAGC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1046681118 8:117171348-117171370 ATGATACCCACGACATTCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1046681112_1046681118 25 Left 1046681112 8:117171300-117171322 CCAAGGGCCTTTGAAACCAGCCC 0: 1
1: 1
2: 1
3: 14
4: 197
Right 1046681118 8:117171348-117171370 ATGATACCCACGACATTCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1046681113_1046681118 18 Left 1046681113 8:117171307-117171329 CCTTTGAAACCAGCCCACTTATT 0: 1
1: 0
2: 0
3: 11
4: 203
Right 1046681118 8:117171348-117171370 ATGATACCCACGACATTCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1046681115_1046681118 5 Left 1046681115 8:117171320-117171342 CCCACTTATTGATGTTGTCATAG 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1046681118 8:117171348-117171370 ATGATACCCACGACATTCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 56
1046681114_1046681118 9 Left 1046681114 8:117171316-117171338 CCAGCCCACTTATTGATGTTGTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1046681118 8:117171348-117171370 ATGATACCCACGACATTCTTGGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046681118 Original CRISPR ATGATACCCACGACATTCTT GGG Intronic