ID: 1046681118 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:117171348-117171370 |
Sequence | ATGATACCCACGACATTCTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 58 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 56} |
Found 5 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1046681116_1046681118 | 4 | Left | 1046681116 | 8:117171321-117171343 | CCACTTATTGATGTTGTCATAGC | 0: 1 1: 0 2: 1 3: 12 4: 101 |
||
Right | 1046681118 | 8:117171348-117171370 | ATGATACCCACGACATTCTTGGG | 0: 1 1: 0 2: 0 3: 1 4: 56 |
||||
1046681113_1046681118 | 18 | Left | 1046681113 | 8:117171307-117171329 | CCTTTGAAACCAGCCCACTTATT | 0: 1 1: 0 2: 0 3: 11 4: 203 |
||
Right | 1046681118 | 8:117171348-117171370 | ATGATACCCACGACATTCTTGGG | 0: 1 1: 0 2: 0 3: 1 4: 56 |
||||
1046681115_1046681118 | 5 | Left | 1046681115 | 8:117171320-117171342 | CCCACTTATTGATGTTGTCATAG | 0: 1 1: 0 2: 2 3: 11 4: 151 |
||
Right | 1046681118 | 8:117171348-117171370 | ATGATACCCACGACATTCTTGGG | 0: 1 1: 0 2: 0 3: 1 4: 56 |
||||
1046681112_1046681118 | 25 | Left | 1046681112 | 8:117171300-117171322 | CCAAGGGCCTTTGAAACCAGCCC | 0: 1 1: 1 2: 1 3: 14 4: 197 |
||
Right | 1046681118 | 8:117171348-117171370 | ATGATACCCACGACATTCTTGGG | 0: 1 1: 0 2: 0 3: 1 4: 56 |
||||
1046681114_1046681118 | 9 | Left | 1046681114 | 8:117171316-117171338 | CCAGCCCACTTATTGATGTTGTC | 0: 1 1: 0 2: 0 3: 6 4: 96 |
||
Right | 1046681118 | 8:117171348-117171370 | ATGATACCCACGACATTCTTGGG | 0: 1 1: 0 2: 0 3: 1 4: 56 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1046681118 | Original CRISPR | ATGATACCCACGACATTCTT GGG | Intronic | ||