ID: 1046681120

View in Genome Browser
Species Human (GRCh38)
Location 8:117171354-117171376
Sequence GTCAGCCCCAAGAATGTCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046681120_1046681124 -8 Left 1046681120 8:117171354-117171376 CCCACGACATTCTTGGGGCTGAC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1046681124 8:117171369-117171391 GGGCTGACTGCAGAGGGCTGAGG No data
1046681120_1046681125 8 Left 1046681120 8:117171354-117171376 CCCACGACATTCTTGGGGCTGAC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1046681125 8:117171385-117171407 GCTGAGGACAGACAGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046681120 Original CRISPR GTCAGCCCCAAGAATGTCGT GGG (reversed) Intronic