ID: 1046681120 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:117171354-117171376 |
| Sequence | GTCAGCCCCAAGAATGTCGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 58 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 54} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046681120_1046681124 | -8 | Left | 1046681120 | 8:117171354-117171376 | CCCACGACATTCTTGGGGCTGAC | 0: 1 1: 0 2: 0 3: 3 4: 54 |
||
| Right | 1046681124 | 8:117171369-117171391 | GGGCTGACTGCAGAGGGCTGAGG | No data | ||||
| 1046681120_1046681125 | 8 | Left | 1046681120 | 8:117171354-117171376 | CCCACGACATTCTTGGGGCTGAC | 0: 1 1: 0 2: 0 3: 3 4: 54 |
||
| Right | 1046681125 | 8:117171385-117171407 | GCTGAGGACAGACAGAACAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046681120 | Original CRISPR | GTCAGCCCCAAGAATGTCGT GGG (reversed) | Intronic | ||