ID: 1046681121

View in Genome Browser
Species Human (GRCh38)
Location 8:117171355-117171377
Sequence AGTCAGCCCCAAGAATGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046681121_1046681125 7 Left 1046681121 8:117171355-117171377 CCACGACATTCTTGGGGCTGACT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1046681125 8:117171385-117171407 GCTGAGGACAGACAGAACAAAGG No data
1046681121_1046681124 -9 Left 1046681121 8:117171355-117171377 CCACGACATTCTTGGGGCTGACT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1046681124 8:117171369-117171391 GGGCTGACTGCAGAGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046681121 Original CRISPR AGTCAGCCCCAAGAATGTCG TGG (reversed) Intronic
901882902 1:12204391-12204413 AAACAGCCCCAAGCATGTGGTGG - Intronic
902456908 1:16539995-16540017 AGTCACCCCCAAAAATGTTTTGG + Intergenic
902495261 1:16867918-16867940 AGTCACCCCCAAAAATGTTTTGG - Intronic
903068276 1:20713471-20713493 TGTCAGCCCCAAGGAGGTCCCGG + Exonic
904345688 1:29867275-29867297 AGCAAGCCCCAAGGATGTCTGGG - Intergenic
908386144 1:63643678-63643700 AGTCTGCCCAAAGAATGGCCGGG - Intronic
915598097 1:156906637-156906659 AGTGTGCCCCAGGAATGTGGGGG + Exonic
1063115333 10:3068197-3068219 CGCCACCCCCTAGAATGTCGAGG + Intronic
1065239659 10:23693674-23693696 ACTCAGCCTCAAGGATGTCTGGG + Intergenic
1070380432 10:75876195-75876217 AGTCAGCCTGAAGAGTGTCCTGG + Intronic
1073181283 10:101585021-101585043 AGTCAGACCTAAGAATGAGGCGG + Intronic
1082758037 11:57097300-57097322 AGTCAGTCCCAGGACTGTTGCGG - Intergenic
1083721748 11:64606980-64607002 AGTCAGCCCCGGGACTGACGAGG + Exonic
1088371252 11:109090674-109090696 AGTCACCCCCTAGAATTTAGAGG - Intergenic
1091586739 12:1821180-1821202 AGACAGCCCCAAGAAACTCGGGG + Intronic
1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG + Intergenic
1100410113 12:94308351-94308373 AGTCAGCCTAAAGAATGTAAAGG - Exonic
1119889975 14:78175246-78175268 GGTCAGCCCCAAGAAGGGAGAGG - Intergenic
1121928940 14:97954538-97954560 AGCCAGCCTCAAGGATCTCGAGG - Intronic
1124172874 15:27392354-27392376 AGTCATCCCCAAAAATGTCAGGG - Intronic
1130170663 15:81509579-81509601 AGACAGCTCCAAGAATTTCAGGG + Intergenic
1132888743 16:2194201-2194223 AGGCAGGCCCAAGAATGCCGTGG - Intronic
1134625772 16:15721430-15721452 GGTCAGCTCCAAGGATGACGTGG - Exonic
1134760081 16:16706485-16706507 AGTCAGCCCCAAGAGAGAAGAGG - Intergenic
1134985990 16:18652720-18652742 AGTCAGCCCCAAGAGAGAAGAGG + Intergenic
1142618066 17:1148115-1148137 AGTAAGCCCAAAGGTTGTCGGGG + Intronic
1157790419 18:50526190-50526212 AGTCAGCCCTAAGAATACCATGG + Intergenic
1161298817 19:3533004-3533026 AGTCACCCCCGAGACTGTCCTGG - Intronic
1166281874 19:41799574-41799596 AGTCAGTGCCAGGAATGTCCGGG + Intronic
1167512587 19:49903607-49903629 AGTAAACCCCAAAAATGTCAGGG - Intronic
926431988 2:12796778-12796800 AGACAGCGCCAAGAAGGTCCTGG + Intergenic
943345461 2:186733403-186733425 AGTCTCCCCCAAGAATTTGGAGG + Intronic
944338810 2:198570110-198570132 TGTCAGCGCTAAAAATGTCGAGG + Intronic
1169274017 20:4221180-4221202 AGACAGCCCCAAGCATGGCCAGG - Exonic
1171164693 20:22959453-22959475 AGCCAGCCCCAAGAATTTCAGGG + Intergenic
1172670222 20:36630043-36630065 GGTCAGCCCCAAGAATATAGTGG - Intronic
964488300 3:157208559-157208581 AGAGAGCCCCAAGAATGCCTTGG + Intergenic
969568129 4:7992242-7992264 AATCAGCCCCCAGATTGTCTGGG + Intronic
980486179 4:133460566-133460588 TTTCAGCCCCAAGAATTGCGTGG + Intergenic
981841384 4:149116669-149116691 ATTCAGCCACAAGAATGACTGGG - Intergenic
989697871 5:44224896-44224918 AGGCAGCCCCAAGGATGCCATGG - Intergenic
990369969 5:55107806-55107828 AGTGAGCCCCAAGAATGACCTGG - Exonic
994215850 5:97136256-97136278 AGACAGCATCAAGAAAGTCGGGG - Intronic
1000255049 5:159529631-159529653 AGTCATAATCAAGAATGTCGAGG + Intergenic
1004545811 6:16597235-16597257 CGTCAGCCGCAAGAATCTCCGGG + Intronic
1005432879 6:25776875-25776897 AGACAGCACCAAGAAGGTCATGG - Exonic
1008659109 6:53647191-53647213 AGACATCCCCAAGATTGTTGTGG + Intergenic
1010207939 6:73339608-73339630 AGTCAGCCCAAAGAATTCCAAGG + Intergenic
1013384792 6:109615879-109615901 AGTCACACCTAAGAATGTAGGGG + Intronic
1014122752 6:117745341-117745363 AGTCTGTCCAAAGAATGACGTGG + Intergenic
1020457982 7:8395946-8395968 AGTCAGATCCCAGAATGTCTTGG - Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1038436245 8:27538824-27538846 AGTCAGCCCTATGCATGCCGAGG - Intronic
1043960862 8:86416970-86416992 AGTGAGTCCCCAGAATGTGGTGG - Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1051238940 9:15031440-15031462 AGCGAGCCCCATGAATGTCTTGG - Intergenic
1052586460 9:30435237-30435259 ATTCATGCCCAAGAATGTTGTGG + Intergenic
1059623655 9:116036676-116036698 TCTCAGCTCCAAGAATGTCTTGG + Intergenic
1060577612 9:124711503-124711525 TGTCAGACCCAAAAATGGCGAGG + Intronic
1061302078 9:129711133-129711155 AGCCAGCCCCAAGATCCTCGTGG - Intronic
1197727761 X:129787807-129787829 AGGTAGCCCCAAGAACATCGAGG + Intronic
1201499934 Y:14630762-14630784 TGTCTTCCTCAAGAATGTCGAGG + Intronic