ID: 1046681121

View in Genome Browser
Species Human (GRCh38)
Location 8:117171355-117171377
Sequence AGTCAGCCCCAAGAATGTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046681121_1046681125 7 Left 1046681121 8:117171355-117171377 CCACGACATTCTTGGGGCTGACT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1046681125 8:117171385-117171407 GCTGAGGACAGACAGAACAAAGG No data
1046681121_1046681124 -9 Left 1046681121 8:117171355-117171377 CCACGACATTCTTGGGGCTGACT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1046681124 8:117171369-117171391 GGGCTGACTGCAGAGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046681121 Original CRISPR AGTCAGCCCCAAGAATGTCG TGG (reversed) Intronic