ID: 1046681122

View in Genome Browser
Species Human (GRCh38)
Location 8:117171362-117171384
Sequence ATTCTTGGGGCTGACTGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 416
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046681115_1046681122 19 Left 1046681115 8:117171320-117171342 CCCACTTATTGATGTTGTCATAG 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1046681122 8:117171362-117171384 ATTCTTGGGGCTGACTGCAGAGG 0: 1
1: 0
2: 3
3: 32
4: 380
1046681116_1046681122 18 Left 1046681116 8:117171321-117171343 CCACTTATTGATGTTGTCATAGC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1046681122 8:117171362-117171384 ATTCTTGGGGCTGACTGCAGAGG 0: 1
1: 0
2: 3
3: 32
4: 380
1046681114_1046681122 23 Left 1046681114 8:117171316-117171338 CCAGCCCACTTATTGATGTTGTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1046681122 8:117171362-117171384 ATTCTTGGGGCTGACTGCAGAGG 0: 1
1: 0
2: 3
3: 32
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046681122 Original CRISPR ATTCTTGGGGCTGACTGCAG AGG Intronic