ID: 1046681124

View in Genome Browser
Species Human (GRCh38)
Location 8:117171369-117171391
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046681114_1046681124 30 Left 1046681114 8:117171316-117171338 CCAGCCCACTTATTGATGTTGTC 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1046681124 8:117171369-117171391 GGGCTGACTGCAGAGGGCTGAGG No data
1046681121_1046681124 -9 Left 1046681121 8:117171355-117171377 CCACGACATTCTTGGGGCTGACT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1046681124 8:117171369-117171391 GGGCTGACTGCAGAGGGCTGAGG No data
1046681116_1046681124 25 Left 1046681116 8:117171321-117171343 CCACTTATTGATGTTGTCATAGC 0: 1
1: 0
2: 1
3: 12
4: 101
Right 1046681124 8:117171369-117171391 GGGCTGACTGCAGAGGGCTGAGG No data
1046681115_1046681124 26 Left 1046681115 8:117171320-117171342 CCCACTTATTGATGTTGTCATAG 0: 1
1: 0
2: 2
3: 11
4: 151
Right 1046681124 8:117171369-117171391 GGGCTGACTGCAGAGGGCTGAGG No data
1046681120_1046681124 -8 Left 1046681120 8:117171354-117171376 CCCACGACATTCTTGGGGCTGAC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1046681124 8:117171369-117171391 GGGCTGACTGCAGAGGGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr