ID: 1046681125

View in Genome Browser
Species Human (GRCh38)
Location 8:117171385-117171407
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046681121_1046681125 7 Left 1046681121 8:117171355-117171377 CCACGACATTCTTGGGGCTGACT 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1046681125 8:117171385-117171407 GCTGAGGACAGACAGAACAAAGG No data
1046681120_1046681125 8 Left 1046681120 8:117171354-117171376 CCCACGACATTCTTGGGGCTGAC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1046681125 8:117171385-117171407 GCTGAGGACAGACAGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr