ID: 1046685800

View in Genome Browser
Species Human (GRCh38)
Location 8:117225534-117225556
Sequence ACCACTGCTCAGATAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046685795_1046685800 0 Left 1046685795 8:117225511-117225533 CCAAGAATTCATGATGAAGGGGG No data
Right 1046685800 8:117225534-117225556 ACCACTGCTCAGATAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046685800 Original CRISPR ACCACTGCTCAGATAGGGAA GGG Intergenic
No off target data available for this crispr