ID: 1046687151

View in Genome Browser
Species Human (GRCh38)
Location 8:117240130-117240152
Sequence CCTGGTGCCACCTGTGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046687151_1046687157 4 Left 1046687151 8:117240130-117240152 CCAGGACCACAGGTGGCACCAGG No data
Right 1046687157 8:117240157-117240179 GGACCCTAAGCCCCAGCCAAGGG No data
1046687151_1046687156 3 Left 1046687151 8:117240130-117240152 CCAGGACCACAGGTGGCACCAGG No data
Right 1046687156 8:117240156-117240178 AGGACCCTAAGCCCCAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046687151 Original CRISPR CCTGGTGCCACCTGTGGTCC TGG (reversed) Intergenic
No off target data available for this crispr