ID: 1046689067

View in Genome Browser
Species Human (GRCh38)
Location 8:117262462-117262484
Sequence GTCCTGTCCCGTGTGGTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046689067_1046689070 10 Left 1046689067 8:117262462-117262484 CCACTAACCACACGGGACAGGAC No data
Right 1046689070 8:117262495-117262517 TCGGCACTTAGAACTTCATCCGG No data
1046689067_1046689069 -9 Left 1046689067 8:117262462-117262484 CCACTAACCACACGGGACAGGAC No data
Right 1046689069 8:117262476-117262498 GGACAGGACTGTCATGACATCGG No data
1046689067_1046689071 21 Left 1046689067 8:117262462-117262484 CCACTAACCACACGGGACAGGAC No data
Right 1046689071 8:117262506-117262528 AACTTCATCCGGCTCTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046689067 Original CRISPR GTCCTGTCCCGTGTGGTTAG TGG (reversed) Intergenic