ID: 1046689069

View in Genome Browser
Species Human (GRCh38)
Location 8:117262476-117262498
Sequence GGACAGGACTGTCATGACAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046689067_1046689069 -9 Left 1046689067 8:117262462-117262484 CCACTAACCACACGGGACAGGAC No data
Right 1046689069 8:117262476-117262498 GGACAGGACTGTCATGACATCGG No data
1046689063_1046689069 7 Left 1046689063 8:117262446-117262468 CCTATCAGTGTTGATTCCACTAA No data
Right 1046689069 8:117262476-117262498 GGACAGGACTGTCATGACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046689069 Original CRISPR GGACAGGACTGTCATGACAT CGG Intergenic
No off target data available for this crispr