ID: 1046689070

View in Genome Browser
Species Human (GRCh38)
Location 8:117262495-117262517
Sequence TCGGCACTTAGAACTTCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046689068_1046689070 3 Left 1046689068 8:117262469-117262491 CCACACGGGACAGGACTGTCATG No data
Right 1046689070 8:117262495-117262517 TCGGCACTTAGAACTTCATCCGG No data
1046689063_1046689070 26 Left 1046689063 8:117262446-117262468 CCTATCAGTGTTGATTCCACTAA No data
Right 1046689070 8:117262495-117262517 TCGGCACTTAGAACTTCATCCGG No data
1046689067_1046689070 10 Left 1046689067 8:117262462-117262484 CCACTAACCACACGGGACAGGAC No data
Right 1046689070 8:117262495-117262517 TCGGCACTTAGAACTTCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046689070 Original CRISPR TCGGCACTTAGAACTTCATC CGG Intergenic
No off target data available for this crispr