ID: 1046689071

View in Genome Browser
Species Human (GRCh38)
Location 8:117262506-117262528
Sequence AACTTCATCCGGCTCTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046689067_1046689071 21 Left 1046689067 8:117262462-117262484 CCACTAACCACACGGGACAGGAC No data
Right 1046689071 8:117262506-117262528 AACTTCATCCGGCTCTCTCAAGG No data
1046689068_1046689071 14 Left 1046689068 8:117262469-117262491 CCACACGGGACAGGACTGTCATG No data
Right 1046689071 8:117262506-117262528 AACTTCATCCGGCTCTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046689071 Original CRISPR AACTTCATCCGGCTCTCTCA AGG Intergenic
No off target data available for this crispr