ID: 1046689910 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:117270984-117271006 |
| Sequence | CCTGCTAGGCTGCTACCCAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1046689903_1046689910 | -4 | Left | 1046689903 | 8:117270965-117270987 | CCCTTTATCTCCCTTTGACCCTG | No data | ||
| Right | 1046689910 | 8:117270984-117271006 | CCTGCTAGGCTGCTACCCAAAGG | No data | ||||
| 1046689902_1046689910 | 10 | Left | 1046689902 | 8:117270951-117270973 | CCGTGTTTGAAAATCCCTTTATC | No data | ||
| Right | 1046689910 | 8:117270984-117271006 | CCTGCTAGGCTGCTACCCAAAGG | No data | ||||
| 1046689904_1046689910 | -5 | Left | 1046689904 | 8:117270966-117270988 | CCTTTATCTCCCTTTGACCCTGC | No data | ||
| Right | 1046689910 | 8:117270984-117271006 | CCTGCTAGGCTGCTACCCAAAGG | No data | ||||
| 1046689901_1046689910 | 25 | Left | 1046689901 | 8:117270936-117270958 | CCTTCTTCATCAGAACCGTGTTT | No data | ||
| Right | 1046689910 | 8:117270984-117271006 | CCTGCTAGGCTGCTACCCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1046689910 | Original CRISPR | CCTGCTAGGCTGCTACCCAA AGG | Intergenic | ||
| No off target data available for this crispr | |||||