ID: 1046689910

View in Genome Browser
Species Human (GRCh38)
Location 8:117270984-117271006
Sequence CCTGCTAGGCTGCTACCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046689903_1046689910 -4 Left 1046689903 8:117270965-117270987 CCCTTTATCTCCCTTTGACCCTG No data
Right 1046689910 8:117270984-117271006 CCTGCTAGGCTGCTACCCAAAGG No data
1046689902_1046689910 10 Left 1046689902 8:117270951-117270973 CCGTGTTTGAAAATCCCTTTATC No data
Right 1046689910 8:117270984-117271006 CCTGCTAGGCTGCTACCCAAAGG No data
1046689904_1046689910 -5 Left 1046689904 8:117270966-117270988 CCTTTATCTCCCTTTGACCCTGC No data
Right 1046689910 8:117270984-117271006 CCTGCTAGGCTGCTACCCAAAGG No data
1046689901_1046689910 25 Left 1046689901 8:117270936-117270958 CCTTCTTCATCAGAACCGTGTTT No data
Right 1046689910 8:117270984-117271006 CCTGCTAGGCTGCTACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046689910 Original CRISPR CCTGCTAGGCTGCTACCCAA AGG Intergenic
No off target data available for this crispr