ID: 1046694285

View in Genome Browser
Species Human (GRCh38)
Location 8:117321272-117321294
Sequence TATTGTGCTCAGAGTGTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046694285_1046694287 -9 Left 1046694285 8:117321272-117321294 CCCAGTACACTCTGAGCACAATA No data
Right 1046694287 8:117321286-117321308 AGCACAATAAAACTACTCCAAGG No data
1046694285_1046694290 29 Left 1046694285 8:117321272-117321294 CCCAGTACACTCTGAGCACAATA No data
Right 1046694290 8:117321324-117321346 TGATTAAAACCAATCATCAATGG No data
1046694285_1046694291 30 Left 1046694285 8:117321272-117321294 CCCAGTACACTCTGAGCACAATA No data
Right 1046694291 8:117321325-117321347 GATTAAAACCAATCATCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046694285 Original CRISPR TATTGTGCTCAGAGTGTACT GGG (reversed) Intergenic
No off target data available for this crispr