ID: 1046704160

View in Genome Browser
Species Human (GRCh38)
Location 8:117432420-117432442
Sequence ACAGAATCAGCATTCCTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046704160_1046704165 8 Left 1046704160 8:117432420-117432442 CCTTGCAGGAATGCTGATTCTGT No data
Right 1046704165 8:117432451-117432473 CATTCCACTCCAGTGTCCATGGG No data
1046704160_1046704164 7 Left 1046704160 8:117432420-117432442 CCTTGCAGGAATGCTGATTCTGT No data
Right 1046704164 8:117432450-117432472 CCATTCCACTCCAGTGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046704160 Original CRISPR ACAGAATCAGCATTCCTGCA AGG (reversed) Intergenic