ID: 1046704165

View in Genome Browser
Species Human (GRCh38)
Location 8:117432451-117432473
Sequence CATTCCACTCCAGTGTCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046704160_1046704165 8 Left 1046704160 8:117432420-117432442 CCTTGCAGGAATGCTGATTCTGT No data
Right 1046704165 8:117432451-117432473 CATTCCACTCCAGTGTCCATGGG No data
1046704159_1046704165 18 Left 1046704159 8:117432410-117432432 CCTAAAACATCCTTGCAGGAATG No data
Right 1046704165 8:117432451-117432473 CATTCCACTCCAGTGTCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046704165 Original CRISPR CATTCCACTCCAGTGTCCAT GGG Intergenic