ID: 1046705405

View in Genome Browser
Species Human (GRCh38)
Location 8:117444456-117444478
Sequence TTGTGTTTGGAGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046705401_1046705405 26 Left 1046705401 8:117444407-117444429 CCTGGTAAAAGAAGTGTGGTGGC No data
Right 1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046705405 Original CRISPR TTGTGTTTGGAGAAGGTGGA AGG Intergenic
No off target data available for this crispr