ID: 1046706827

View in Genome Browser
Species Human (GRCh38)
Location 8:117463432-117463454
Sequence TCCAGGGCCTTGGGGGTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046706827_1046706835 16 Left 1046706827 8:117463432-117463454 CCTAATACCCCCAAGGCCCTGGA No data
Right 1046706835 8:117463471-117463493 CTGTTTCTCCATAATGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046706827 Original CRISPR TCCAGGGCCTTGGGGGTATT AGG (reversed) Intergenic
No off target data available for this crispr