ID: 1046706835

View in Genome Browser
Species Human (GRCh38)
Location 8:117463471-117463493
Sequence CTGTTTCTCCATAATGTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046706829_1046706835 8 Left 1046706829 8:117463440-117463462 CCCCAAGGCCCTGGATAGCTAGA No data
Right 1046706835 8:117463471-117463493 CTGTTTCTCCATAATGTCCTAGG No data
1046706827_1046706835 16 Left 1046706827 8:117463432-117463454 CCTAATACCCCCAAGGCCCTGGA No data
Right 1046706835 8:117463471-117463493 CTGTTTCTCCATAATGTCCTAGG No data
1046706828_1046706835 9 Left 1046706828 8:117463439-117463461 CCCCCAAGGCCCTGGATAGCTAG No data
Right 1046706835 8:117463471-117463493 CTGTTTCTCCATAATGTCCTAGG No data
1046706832_1046706835 0 Left 1046706832 8:117463448-117463470 CCCTGGATAGCTAGACTCCTTCT No data
Right 1046706835 8:117463471-117463493 CTGTTTCTCCATAATGTCCTAGG No data
1046706833_1046706835 -1 Left 1046706833 8:117463449-117463471 CCTGGATAGCTAGACTCCTTCTC No data
Right 1046706835 8:117463471-117463493 CTGTTTCTCCATAATGTCCTAGG No data
1046706831_1046706835 6 Left 1046706831 8:117463442-117463464 CCAAGGCCCTGGATAGCTAGACT No data
Right 1046706835 8:117463471-117463493 CTGTTTCTCCATAATGTCCTAGG No data
1046706830_1046706835 7 Left 1046706830 8:117463441-117463463 CCCAAGGCCCTGGATAGCTAGAC No data
Right 1046706835 8:117463471-117463493 CTGTTTCTCCATAATGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046706835 Original CRISPR CTGTTTCTCCATAATGTCCT AGG Intergenic
No off target data available for this crispr