ID: 1046707079

View in Genome Browser
Species Human (GRCh38)
Location 8:117466833-117466855
Sequence GAGAAAGCACAGAGGCAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046707079_1046707085 17 Left 1046707079 8:117466833-117466855 CCCAACTGCCTCTGTGCTTTCTC No data
Right 1046707085 8:117466873-117466895 CTTAAATTCTTTCTACCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046707079 Original CRISPR GAGAAAGCACAGAGGCAGTT GGG (reversed) Intergenic
No off target data available for this crispr