ID: 1046707264

View in Genome Browser
Species Human (GRCh38)
Location 8:117468787-117468809
Sequence CTTGATATACAGATCAATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046707256_1046707264 21 Left 1046707256 8:117468743-117468765 CCCCTCCAGAAGTTATTACAGAA No data
Right 1046707264 8:117468787-117468809 CTTGATATACAGATCAATCTAGG No data
1046707258_1046707264 19 Left 1046707258 8:117468745-117468767 CCTCCAGAAGTTATTACAGAAAT No data
Right 1046707264 8:117468787-117468809 CTTGATATACAGATCAATCTAGG No data
1046707257_1046707264 20 Left 1046707257 8:117468744-117468766 CCCTCCAGAAGTTATTACAGAAA No data
Right 1046707264 8:117468787-117468809 CTTGATATACAGATCAATCTAGG No data
1046707259_1046707264 16 Left 1046707259 8:117468748-117468770 CCAGAAGTTATTACAGAAATTGT No data
Right 1046707264 8:117468787-117468809 CTTGATATACAGATCAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046707264 Original CRISPR CTTGATATACAGATCAATCT AGG Intergenic
No off target data available for this crispr