ID: 1046710542

View in Genome Browser
Species Human (GRCh38)
Location 8:117506400-117506422
Sequence CCACAGTTGCACCTCTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1046710539_1046710542 18 Left 1046710539 8:117506359-117506381 CCATACACATGGTATTAAATATC No data
Right 1046710542 8:117506400-117506422 CCACAGTTGCACCTCTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1046710542 Original CRISPR CCACAGTTGCACCTCTAGCC TGG Intergenic
No off target data available for this crispr